ID: 1036165462

View in Genome Browser
Species Human (GRCh38)
Location 8:6428841-6428863
Sequence AGGAGCTGCCTCTGGGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 403}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036165462_1036165466 -10 Left 1036165462 8:6428841-6428863 CCTGTTCCCCAGAGGCAGCTCCT 0: 1
1: 0
2: 2
3: 33
4: 403
Right 1036165466 8:6428854-6428876 GGCAGCTCCTTTCACACTTGTGG No data
1036165462_1036165468 15 Left 1036165462 8:6428841-6428863 CCTGTTCCCCAGAGGCAGCTCCT 0: 1
1: 0
2: 2
3: 33
4: 403
Right 1036165468 8:6428879-6428901 GCTTCTGCAGATAAGCTGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036165462 Original CRISPR AGGAGCTGCCTCTGGGGAAC AGG (reversed) Intronic
900300768 1:1976041-1976063 AGGCACTGCCTTTGAGGAACAGG - Intronic
900369020 1:2323295-2323317 TGGAGCTGCCTCTGGCGCAGCGG - Intronic
900567149 1:3339129-3339151 AGGAGATGCCTCTGAGCACCCGG - Intronic
900608937 1:3536324-3536346 AGGACATGGCTCTGGGGTACGGG + Intronic
901000285 1:6145639-6145661 AAGAGCTGCTGCTGGGGCACTGG + Intronic
901125498 1:6925771-6925793 TGGAGATGCCTCTTGGGAAGAGG - Intronic
901150728 1:7099459-7099481 AGCAGCCGCCCCTGGGAAACAGG - Intronic
901671870 1:10860795-10860817 AGGGTGTGACTCTGGGGAACTGG + Intergenic
903357119 1:22754979-22755001 TGGAGCTGTCTCTAGGGCACAGG - Intronic
903374928 1:22859902-22859924 AGGAGGTGCTAATGGGGAACAGG - Intronic
903928414 1:26848492-26848514 AGGAGAAGCCTCAGGGTAACAGG - Intronic
903951821 1:26999997-27000019 AGGGGCTGGTTCTGGAGAACTGG + Exonic
904590761 1:31614207-31614229 AGGACCTGGATATGGGGAACAGG + Intergenic
906142272 1:43540800-43540822 AGGAGGGGCCTGTGGGGAAGAGG - Intronic
906500926 1:46341422-46341444 TCGAGCTGCCTCTGGCGACCGGG + Intronic
906696076 1:47824292-47824314 CAGACCTGCCTCTGTGGAACTGG - Intronic
906806451 1:48783396-48783418 AGGAGCTGCATGTTGGGTACAGG + Intronic
908128165 1:61050583-61050605 AGGAGCTGCGGCTTGGGAAGGGG + Intronic
910262886 1:85308469-85308491 AAAAGATGCCTCTGGGGAAAAGG + Intergenic
912450309 1:109764151-109764173 AGGTGCCTACTCTGGGGAACAGG + Intronic
913185697 1:116369014-116369036 AGGTTGTGCCTCTGGGAAACTGG - Intergenic
914680658 1:149936278-149936300 GGCAGCTGCCTCTGGGGAGTTGG - Intronic
917495994 1:175540702-175540724 AGTGGCTACCTCTGGGGAAGGGG - Intronic
918134473 1:181659265-181659287 GGCACCTGCCTCTGGGGCACAGG + Intronic
920210133 1:204321919-204321941 AGGAGCTGCCCCTGGGGCTCTGG + Intronic
920403809 1:205694044-205694066 AGGAGCTGCCACAGGGCAAGTGG + Intergenic
920725232 1:208428670-208428692 CTGAGTTGCCTCTAGGGAACAGG + Intergenic
921192249 1:212721118-212721140 AGCAGTTGCCTCTGGGTAAAGGG - Intergenic
921900101 1:220441042-220441064 AGGATCTGCCTGTGGGAAAGCGG + Intergenic
922511912 1:226175719-226175741 AGCAGCTGCCTCTGGGGAGAAGG + Intronic
923034086 1:230272026-230272048 AGGAGCTGTTTGTTGGGAACCGG + Intronic
923447026 1:234081449-234081471 AGGTCCTGACTCTGGGAAACAGG - Intronic
924465846 1:244298611-244298633 AGCAGCTGACTTTGGGGAAAGGG + Intergenic
924659888 1:246006434-246006456 AGGAGTTCCGTCTGGGAAACAGG - Intronic
1062889741 10:1049171-1049193 GGACGCTGCCTCTGCGGAACTGG - Intergenic
1062922799 10:1292815-1292837 AGGAGCTTTCTCTGGAGAACAGG - Intronic
1063256586 10:4334576-4334598 ATCAGGTGCCTCTGGGGGACAGG + Intergenic
1065785907 10:29214578-29214600 AGCAGCTGCCCCTGGGAAAGGGG - Intergenic
1067278887 10:44856622-44856644 AGGAGCTGCCTGAGGAAAACAGG + Intergenic
1067529889 10:47062620-47062642 AGTGATTGCCTCTGGGGAACGGG - Intergenic
1068973502 10:62983424-62983446 AGGAGCAGCTTCTGGGCTACAGG - Intergenic
1070734159 10:78852105-78852127 TGGAGCAGCCTCTGGGGATAAGG - Intergenic
1072044136 10:91637800-91637822 AGGAGAAGCCTCTGGGGGTCAGG + Intergenic
1073436360 10:103518829-103518851 AGGGGCTACCTCTGGAGAATTGG + Intronic
1073596252 10:104803408-104803430 AGGAGCTGCCTGTAGGGGAATGG + Intronic
1074544121 10:114389163-114389185 AGGTCCTGCCTCTGGGGCCCAGG + Intronic
1074591515 10:114818151-114818173 AGAGGTTGCCTCTGTGGAACAGG - Intergenic
1075739344 10:124684543-124684565 AGGACCTGCCTCTGTGGCCCAGG + Intronic
1076739742 10:132477387-132477409 AGGAGCAGCCTCTGGGTCAGGGG - Intergenic
1076848317 10:133080745-133080767 AGGAGCTGCCTCTTGGAGCCTGG - Intronic
1076916250 10:133424269-133424291 AGGGACTGCCCCTGGGGCACGGG - Intronic
1077035626 11:493127-493149 AGGGGCTGCCTTTGGGACACGGG - Intergenic
1077538548 11:3135784-3135806 AGGAGGTGCCTGTGGTTAACAGG - Intronic
1079999719 11:27333683-27333705 TGGAGGTGCCAATGGGGAACAGG - Intronic
1080457440 11:32429579-32429601 TGTTGCTGCCTCTGGGGAAAAGG + Intronic
1080515276 11:33014577-33014599 AGAAGCTGCCCCTGGGGACTTGG - Intergenic
1080974808 11:37325906-37325928 AGGGGCTGCCTGAGGGGTACAGG - Intergenic
1081762295 11:45584840-45584862 ATGGGCTGCCTCTGGGGTGCAGG - Intergenic
1083259925 11:61517392-61517414 AGGAGCTGCTCCCGGGGACCAGG + Intronic
1083947400 11:65931934-65931956 AGACGCTGCCTTTGGAGAACAGG + Intergenic
1084185251 11:67467981-67468003 AGGAGCTGGGGCTGGGGTACAGG + Intronic
1084849733 11:71929091-71929113 AGGTGGTGCTGCTGGGGAACGGG + Exonic
1085057148 11:73411694-73411716 GGGAGCTGCCTCTGGGGCCAGGG - Intronic
1085413447 11:76305517-76305539 AAGACCTGCCTCTGGGGCCCTGG + Intergenic
1085457431 11:76672876-76672898 TGCAGATGCCTCTGGGGACCAGG + Intergenic
1085482910 11:76837604-76837626 AGGAGGTGCCTCGGGGGAGATGG - Intergenic
1088441017 11:109870318-109870340 AGAAGCTCCCTCTAGGGAGCGGG - Intergenic
1090334069 11:125951076-125951098 AGACGCTGCCACTGGGGAGCTGG - Intergenic
1090354694 11:126132325-126132347 AATATCTGCCTCTGGTGAACTGG + Intergenic
1090433736 11:126668507-126668529 GGGAGCTGCCCCTGGGGAAGAGG + Intronic
1090493249 11:127184632-127184654 AGATCCTGTCTCTGGGGAACAGG + Intergenic
1091025157 11:132135415-132135437 AGAATCTGCCTCTAGAGAACTGG - Intronic
1091624217 12:2110229-2110251 AGGTGCTGCTGCTGGGGACCAGG - Intronic
1091889010 12:4038159-4038181 AGCACCTGCCACAGGGGAACTGG - Intergenic
1092117733 12:6021364-6021386 TGGACTTGCCTCTGGGAAACTGG - Intronic
1092147123 12:6222436-6222458 AGCAGCTGGCTCTGGAGAAATGG - Intronic
1092287422 12:7136827-7136849 AGGTGCTGCCACTGGGGAGGTGG + Exonic
1094465481 12:30749676-30749698 AGGAGCAGGTTTTGGGGAACAGG + Intronic
1094825296 12:34264793-34264815 CCAAGCTGCCTCTGGGGAAGTGG - Intergenic
1095085263 12:38053312-38053334 CCAAGCTGCCTCTGGGGAAGTGG + Intergenic
1095632885 12:44398623-44398645 AGGAGCTGGCTCCTGAGAACAGG + Intergenic
1096510201 12:52123603-52123625 AGGAGCAGCCTCTGGCTAAATGG + Intergenic
1097281314 12:57846658-57846680 CGGAGCTGCCGCTGGGGGATCGG - Exonic
1098032171 12:66266308-66266330 AGGGGGTGCATGTGGGGAACAGG - Intergenic
1099996357 12:89783663-89783685 AGGGGCAGCCTCTGTGGAAGGGG + Intergenic
1100650257 12:96579617-96579639 AGGAGTTGCCTCTGGGAAGAAGG + Intronic
1101783865 12:107864568-107864590 AGGAGCTCCCTCTGGGCTGCTGG + Intergenic
1102491524 12:113292255-113292277 AGGAGAAGCCTCTGGAGGACGGG - Intronic
1103077196 12:117993574-117993596 GGTGGCTGCCTCTGGGGAGCAGG - Intergenic
1103518283 12:121521382-121521404 AAAAGCTTCCTCTGGGGACCTGG + Intronic
1103556926 12:121771909-121771931 AAGGGTTGCCTCTGGGGAAGGGG + Intronic
1103581196 12:121916857-121916879 AGTAGCTCCCTTTGGAGAACAGG + Exonic
1104748913 12:131226382-131226404 AGGATCTGCTTCTGGGGACCAGG - Intergenic
1104784209 12:131439182-131439204 AGGATCTGCTTCCGGGGACCAGG + Intergenic
1104856435 12:131904528-131904550 AGGAGCTCCCTCTGGGCAGGGGG - Intronic
1106074039 13:26441965-26441987 GGGTGCTGCTTCTGGGAAACTGG + Intergenic
1107947260 13:45430416-45430438 AGTAGTTGCCTCTGGGCATCGGG + Intergenic
1110015010 13:70389046-70389068 AGGAGCTGCACCTGAGGCACTGG + Intergenic
1110278914 13:73670045-73670067 AGGAGCTGCCTCTGAAGCAAGGG - Intergenic
1113146368 13:107212507-107212529 AGAGGCTGCCTCAGGGGGACAGG + Intronic
1113544647 13:111138839-111138861 AAGAGCTGGGTCTGGAGAACCGG + Intronic
1113563965 13:111306763-111306785 AGGAGCTACTTCTGGGGAACAGG - Intergenic
1113600785 13:111566752-111566774 GGGAGATGCCTCTGAGGACCGGG + Intergenic
1113992984 14:16042735-16042757 CCAAGCTGCCTCTGGGGAAGTGG - Intergenic
1115549355 14:34491145-34491167 GGGAGGTGCCTGAGGGGAACAGG - Intergenic
1117570067 14:57039069-57039091 AGCAGTTGCTGCTGGGGAACAGG + Intergenic
1118222900 14:63871945-63871967 AGCAGCTTCCTCTGGGGAGGAGG - Intronic
1119777803 14:77259226-77259248 AGGAGCTGCCGCCCAGGAACCGG + Exonic
1120770992 14:88380225-88380247 GGGAGCTGCTGCTGGGGAATGGG + Intergenic
1121699473 14:95941612-95941634 AGGAGCTGCTTTTTGGGAACTGG + Intergenic
1121719461 14:96098984-96099006 AGGAAGTGCTTCTGGGAAACAGG - Intergenic
1121884342 14:97529440-97529462 AGGAGCTGACTTTGGGGGCCAGG + Intergenic
1122158854 14:99768409-99768431 TGGAGCTGCCTCGGAGGAAGAGG + Intronic
1122418449 14:101561226-101561248 AGCCGCTGCCGCTGGGGACCGGG - Intergenic
1122720826 14:103721378-103721400 AGGAGCTGTCTCAAGGGAAGCGG - Intronic
1123041774 14:105493169-105493191 AGGGGCTGGCTCAGGGGCACAGG + Intronic
1124625950 15:31307586-31307608 AGGAGGAGCTTCTGGGGAAGAGG - Intergenic
1124829278 15:33132413-33132435 AGAAGCTGCCTGTGTGCAACTGG + Intronic
1125105188 15:35962520-35962542 AGGAGCTGCCTAGGGGGAAAAGG + Intergenic
1125587229 15:40829348-40829370 AGCAGTTGCCTCAGGGGAGCGGG - Intergenic
1125721753 15:41848481-41848503 AGAAGCTGGGCCTGGGGAACTGG + Exonic
1125790211 15:42359855-42359877 AGGAACTGGCCCTGGGGACCGGG - Exonic
1126191817 15:45886098-45886120 AGGAGCTCCCTCTGGGCTGCTGG + Intergenic
1130044712 15:80434970-80434992 AGGTGCTGCCTCTCAGGAGCAGG - Intronic
1131134706 15:89925017-89925039 GGTGGCTGCCTCTGGGGGACTGG + Intergenic
1131452897 15:92560972-92560994 AGGGTCTGCTTCTGGGGAACTGG - Intergenic
1131730128 15:95270720-95270742 GGGAGCTAGCTCTAGGGAACAGG - Intergenic
1132179936 15:99744650-99744672 AAGAGTGGCCTCTTGGGAACCGG + Intergenic
1132655016 16:1038171-1038193 AGGAGAGGCCTGTGGGGACCTGG - Intergenic
1133283839 16:4681484-4681506 AGGAGGAGCGTCTGGGGAGCAGG + Intronic
1135197571 16:20407312-20407334 AGGAGCTGCCTGCGTGGAAATGG + Intergenic
1135303655 16:21351007-21351029 AGGAGCTGCCTTTGAGGGGCAGG + Intergenic
1136243067 16:28956370-28956392 AGGAGCTGCTTCTGGAGAGATGG + Intronic
1136300400 16:29330202-29330224 AGGAGCTGCCTTTGAGGGGCAGG + Intergenic
1136912351 16:34154487-34154509 CCAAGCTGCCTCTGGGGAAGTGG - Intergenic
1137550303 16:49433047-49433069 AGGAGCTGCTTCTGGGCATAGGG + Intergenic
1137623284 16:49891092-49891114 TGGAGCTGCATCTGGGGAGGAGG + Intergenic
1138756648 16:59494292-59494314 AGGAGCGGCCTCTGGTGGTCTGG + Intergenic
1139283787 16:65792575-65792597 AGCAGGTGCCTCTGGGGATAGGG + Intergenic
1141524483 16:84603108-84603130 TGGAGAGGCCTCCGGGGAACTGG - Intronic
1142062125 16:88036968-88036990 AGGAGCTGCCTTTGAGGGGCAGG + Intronic
1142267529 16:89071328-89071350 GGGAGCTTCCGCAGGGGAACCGG + Intergenic
1142981739 17:3676393-3676415 ACTGGCTGCCTCTGGGGAACCGG + Intronic
1144726937 17:17506824-17506846 AGGATCTGGCTGTGGGGAAGGGG + Intronic
1145142867 17:20459294-20459316 AGGATCTGTCTCTGTGCAACAGG + Intronic
1145265295 17:21376958-21376980 AGGCGCGGCCTGCGGGGAACTGG - Intronic
1145757597 17:27404045-27404067 AGGAGCCTCCTCTGGGCATCTGG - Intergenic
1145781739 17:27568129-27568151 AGGGGCTGCCTGAGGGGAGCAGG + Intronic
1146482621 17:33217183-33217205 AGGAAGTGCCTCTAGGAAACAGG - Intronic
1146889679 17:36498331-36498353 TGGGGCTGCCCCTGGGGAGCTGG + Exonic
1147495674 17:40912746-40912768 AGGAGTTGACTCGGTGGAACGGG + Intergenic
1148271633 17:46266500-46266522 AGGGGCAGCCTTTGGGGAAACGG - Intergenic
1148446613 17:47741730-47741752 AGGAACTGCCTGTGGAGAGCTGG + Intronic
1149308327 17:55370785-55370807 TGAAGCTGACTCTGGGGAAGAGG - Intergenic
1149503644 17:57174893-57174915 AGGTGCTGCCTCAGGTCAACAGG + Intergenic
1150265952 17:63832571-63832593 CAGAGCTGGCTCTGGGGAGCTGG - Exonic
1150337551 17:64341716-64341738 AGTAGCTGCCTCTGGGAACGAGG + Intronic
1150705104 17:67479321-67479343 AGCAGCTGCCCATGAGGAACAGG + Intronic
1150765148 17:67996302-67996324 AGGGGCAGCCTTTGGGGAAACGG + Intergenic
1150837277 17:68575947-68575969 AGGAGCTAACCCTGGGGAAGTGG + Intronic
1150902814 17:69300391-69300413 ACTAGCTGCCTGTGAGGAACTGG - Intronic
1150940674 17:69690122-69690144 AGTAGTTGCTTCTGGGGAATGGG + Intergenic
1151358352 17:73573440-73573462 TGGAGAAGCCTCTGGGGAACTGG - Intronic
1151444798 17:74156232-74156254 GGGAGCTGCCTCCTGGGAGCTGG - Intergenic
1151539693 17:74758740-74758762 GGGTTCTGCCTCTGGGGAAAGGG - Intronic
1151786876 17:76279420-76279442 AGGAGCTGCCTGTTAGGAATGGG + Exonic
1151842324 17:76627187-76627209 AGCAGCTGCTGCTGGGGCACTGG + Exonic
1151902364 17:77024947-77024969 AGGAGCTGCCTGGTGGAAACAGG - Intergenic
1152017102 17:77757926-77757948 AGGGGCTCCCCCTGGGGACCAGG + Intergenic
1152370617 17:79886441-79886463 AGCAGCTGTCTCTGGAGAACAGG - Intergenic
1152572519 17:81127031-81127053 AGGAGCTGCATATGTGGAAGGGG + Intronic
1152916006 17:83036344-83036366 AGCAGCTGCCCTTGGGGAAGGGG + Intronic
1155012983 18:21801106-21801128 AATAGCTGCCTCTGTAGAACAGG - Intronic
1155876919 18:31100883-31100905 GGGAGCAGCGTCTGGGGAATTGG - Intronic
1156524010 18:37749421-37749443 AGTAGTTACCTCTGGGGAAAGGG - Intergenic
1157851895 18:51062424-51062446 AGTAGCTACCTCTGGGGAGAAGG - Intronic
1159162884 18:64667166-64667188 AGGAACTGCCTCTCAGGTACTGG - Intergenic
1160231802 18:77054437-77054459 TGGAGAGGCCCCTGGGGAACAGG + Intronic
1160254844 18:77239612-77239634 AGCAGCAGCCCCTGGGGGACGGG - Intergenic
1161103442 19:2432503-2432525 AGGATCAGTCTCTGGGGAACTGG - Exonic
1161250236 19:3276224-3276246 AGGAGCTGCCTCTGAGGGCGGGG + Intronic
1161506221 19:4645166-4645188 AGGAGGTGGCTCTGGTGAGCTGG - Intronic
1162919141 19:13890004-13890026 AGGAGCTGATGCTGGGGTACAGG + Exonic
1162964367 19:14149055-14149077 AGGGGCCACCTCTGGGGAAACGG + Exonic
1163251064 19:16126575-16126597 AGGAGCTGCCTTTGGGTATGAGG + Intronic
1163676497 19:18658005-18658027 GGGAGCTGCCTTTGTGGAATGGG + Intronic
1164438736 19:28255040-28255062 AGAAGCAGCCTCTGGAGAAAAGG - Intergenic
1164772085 19:30816999-30817021 TGGAGGTGCCTCTGGTCAACCGG + Intergenic
1164796683 19:31039471-31039493 AGGCTGTGCTTCTGGGGAACTGG - Intergenic
1164822320 19:31259750-31259772 AGGAGCTGCATTTAGGGAAGAGG + Intergenic
1164839008 19:31378464-31378486 AGGAGCTGACATTTGGGAACGGG - Intergenic
1164949645 19:32326462-32326484 GGGGGCTGCCACTGGGGGACAGG + Intergenic
1165076136 19:33280973-33280995 AGGAGCTGCCCCTGGTGACCTGG - Intergenic
1165544521 19:36523463-36523485 AGTGGCTGCTTCTGGGAAACAGG + Intronic
1166194839 19:41198745-41198767 AGGAGCTGCTTGTGGGGGCCTGG - Exonic
1167517184 19:49930145-49930167 AGGCGGGGCCTCTGGGGAATCGG + Intronic
1168166286 19:54550241-54550263 AGGACCTGGCTCTGGGTAGCTGG - Intergenic
925314332 2:2909582-2909604 AGGAGGTGCCTCTGCGGGGCTGG + Intergenic
925426302 2:3751409-3751431 CGGAGCTGCACCTGGGGAGCTGG - Intronic
925692075 2:6535657-6535679 AGCAGCTGCCTGTGGGGCAGTGG - Intergenic
926460256 2:13120925-13120947 AGCAGTTGCCACTGGGGAACGGG + Intergenic
926731619 2:16039764-16039786 AGTCACTGCCTCTGGGGAAAAGG - Intergenic
927217336 2:20675457-20675479 AGCAGCTGCCTCTGGGCACTCGG - Intergenic
927431849 2:23033236-23033258 AGGAGGTGAATCTCGGGAACAGG - Intergenic
927434301 2:23054030-23054052 AGGAGCTGCCACTGTTGAATGGG - Intergenic
928410988 2:31053595-31053617 AGCAGATGCCTCAGGGGAAGTGG - Intronic
929003272 2:37368618-37368640 AGGAGCTGCCAATGGATAACAGG - Intronic
929579146 2:43070789-43070811 ATGAGCTGACTCTAGGGGACAGG - Intergenic
930501278 2:52221367-52221389 AGTATCTCCCTCTGGGGAAGAGG + Intergenic
930724049 2:54665521-54665543 AGGAGCTGCTGCTGGAGGACAGG + Intronic
931228121 2:60351524-60351546 GGCAGCTGCCTCTGGGGCCCGGG - Intergenic
931702633 2:64921425-64921447 AGTAGTTGGCTCTGGGGAGCAGG - Intergenic
932366516 2:71156644-71156666 AGCAGCTGCCTCTGGGGGAGGGG - Intergenic
932751326 2:74373503-74373525 AGGATCTGGTTCTGGGGAAGGGG - Intronic
932812361 2:74835324-74835346 AGGATCTGCCTCTGAGTAAGGGG + Intronic
932952915 2:76315202-76315224 AAAAACTGCCACTGGGGAACAGG - Intergenic
933536570 2:83583081-83583103 AGGAGCTGCCTCAGCGCAAGAGG - Intergenic
933774036 2:85761090-85761112 AGGAGCTGCCTCTAGGGGTCGGG + Intronic
934035768 2:88087521-88087543 AGGAGCTGGCTCTGTGATACTGG - Intronic
935060739 2:99605458-99605480 AGGAGTTGCCTTTGTGGAAGTGG - Intronic
935375155 2:102388172-102388194 GGGAGCTGCCCCTGGGCACCAGG - Intronic
936281169 2:111141165-111141187 AGTTGGTGCCTATGGGGAACTGG + Intronic
936457492 2:112686537-112686559 AGGAGCCGCCTGTGGGGAGCAGG - Intergenic
936601643 2:113902145-113902167 AGTAACTGCCTCTGAGGAAAGGG - Intronic
937305602 2:120868645-120868667 GGGAGCTGCCTTTTGGGAAATGG + Intronic
938243501 2:129760730-129760752 AGGAGCTGCCTCAGGACAACAGG - Intergenic
938538718 2:132268147-132268169 CCAAGCTGCCTCTGGGGAAGTGG + Intergenic
938971789 2:136439477-136439499 AGGGGCTGCCTTTGGGGTAGAGG + Intergenic
939302834 2:140368681-140368703 AGGAGCTGAGTGTTGGGAACTGG - Intronic
942145591 2:173023454-173023476 AGGCGCTTCCTCTGGGGTCCAGG + Intronic
942902727 2:181141909-181141931 AGGAGCTACGTGTGGGTAACAGG - Intergenic
943774407 2:191749910-191749932 AGGAACTGAATCTGGGGTACCGG - Intergenic
945437011 2:209830812-209830834 AGGAGGTGGCTCTGAGGAAGAGG + Intronic
947552892 2:231059636-231059658 AATACCTGCCTCTGGGGATCAGG - Intronic
947913154 2:233814739-233814761 AGGGCCAGACTCTGGGGAACAGG + Intronic
948077951 2:235181283-235181305 AGGAGCTTCCCCTGGAGAAGGGG - Intergenic
948411221 2:237762802-237762824 AGGTGCTACCTATGAGGAACAGG + Exonic
948793676 2:240391631-240391653 AGGGTCTGCCTCTGGGTAATGGG + Intergenic
948924626 2:241087471-241087493 AACAGGTGCCTCTGGGGAGCAGG + Exonic
1168772528 20:424512-424534 AGGTTCTGCCCCTGGGGAAAAGG + Intronic
1169497555 20:6129813-6129835 AATAGTTGCCTCTGGGGAATGGG + Intergenic
1169611874 20:7390109-7390131 AGGAGGTGCCTCTGATGAAAAGG + Intergenic
1170172447 20:13430447-13430469 AACAGCTGCTTCTGAGGAACCGG - Intronic
1170766335 20:19292507-19292529 TGGAGCTTTTTCTGGGGAACGGG + Intronic
1171002404 20:21427955-21427977 AGGAGCTACCCCTAGGGAATAGG + Intergenic
1171812044 20:29753042-29753064 GGAAGCTACCTCTGGGGAAGTGG + Intergenic
1171867633 20:30500110-30500132 CCAAGCTGCCTCTGGGGAAGTGG + Intergenic
1171907635 20:30912634-30912656 CCAAGCTGCCTCTGGGGAAGTGG - Intergenic
1172136721 20:32691233-32691255 AGTGGCTACCTCTGGGGAATAGG + Intergenic
1172593214 20:36132006-36132028 TGGATATACCTCTGGGGAACAGG - Intronic
1172783639 20:37451793-37451815 GGAAGCTGCCCTTGGGGAACGGG - Intergenic
1173475170 20:43353636-43353658 AGGGGCTGGCTCTGGGGACAGGG - Intergenic
1173554131 20:43953596-43953618 AGGACTTGTCTCTGGGGAAAGGG + Intronic
1173569452 20:44067165-44067187 AGGCTCTGCTTCTAGGGAACTGG - Intronic
1173860433 20:46279660-46279682 AGGAGCTGGCGCTGAGGAAGTGG + Intronic
1175148172 20:56912254-56912276 AGGGGCTGGCACTGGGCAACAGG + Intergenic
1175932600 20:62499727-62499749 AGCAGCTGCCTCTGAGAACCTGG + Intergenic
1175972453 20:62693567-62693589 AGGGGCTGCTTCTGGGGAACCGG - Intergenic
1178485578 21:33018254-33018276 AGTAGTTGCCTCTGGGGGTCTGG + Intergenic
1180032415 21:45221581-45221603 GGGTGCTGCCCCTGGTGAACAGG - Intronic
1180095780 21:45554910-45554932 AGGGGCTGCTTCTGGGGAGAAGG - Intergenic
1180314284 22:11264784-11264806 CCAAGCTGCCTCTGGGGAAGTGG + Intergenic
1180341074 22:11618767-11618789 CCAAGCTGCCTCTGGGGAAGTGG - Intergenic
1180569174 22:16699777-16699799 TGGACTTGCCTCTGGGAAACTGG - Intergenic
1181786306 22:25229769-25229791 TAGAGCTGCCTTTGGGGAAATGG + Intronic
1181818477 22:25457592-25457614 TAGAGCTGCCTTTGGGGAAATGG + Intergenic
1182327393 22:29524098-29524120 AGGAGATGCCACTGTGAAACTGG - Intronic
1182529356 22:30943528-30943550 GGGAGGAGCCTCTGGGGAAGTGG - Intronic
1182786286 22:32910378-32910400 AGGAGGCGCCTCTGTGGAACAGG + Intronic
1183745836 22:39691196-39691218 AGGGGCAGCCTGAGGGGAACAGG - Intergenic
1184249183 22:43250580-43250602 AGGAGCAGCCTCAGGGGTGCGGG + Intronic
1184518266 22:44976597-44976619 AGTTGCAGCCTCTGGGGAGCTGG + Intronic
1184671233 22:46013180-46013202 AGGAGCTCCCTCTGGGGCAAGGG + Intergenic
1184751893 22:46491052-46491074 AGAAGCTGCCTCAGGAGACCTGG - Intronic
1185287797 22:50010334-50010356 CGGGGCAGCCTCTGGGGAACGGG + Intronic
949890245 3:8728408-8728430 TGGAGCAGGCTCTGGGGAAGGGG - Intronic
950168044 3:10816279-10816301 AGGCGCTGCCCCTGGGCAATGGG + Exonic
950177257 3:10883478-10883500 AGGAGGTGGATCTGGGGAACTGG - Intronic
950294374 3:11815859-11815881 AGCAGCTGCCTCTGGTAAGCAGG + Intronic
950518848 3:13484425-13484447 AGGAGCCGCCCCTTGGGAAGGGG - Intronic
950614371 3:14147350-14147372 AGAAGCGGGCTCTAGGGAACTGG - Exonic
951258688 3:20481690-20481712 AGCAGCTGCCACTGAGGGACTGG + Intergenic
951273883 3:20661360-20661382 AGTGGCTGCCTCTGGGCAAAAGG - Intergenic
954333979 3:49905586-49905608 AGCAGCTGCCCCTTGGTAACTGG + Intronic
955506730 3:59639979-59640001 AGGAGCTGTGTCTTTGGAACTGG + Intergenic
956004540 3:64764187-64764209 AGGTGCTGCTTATGAGGAACAGG + Intergenic
957297860 3:78355221-78355243 ACAAGCTGCTTCTGGGCAACTGG + Intergenic
961403557 3:126663741-126663763 AAGAGCAGCCTCTGGGGGTCTGG - Intergenic
961821348 3:129577247-129577269 AGGAGCAGGCCCTGGGGAGCAGG + Intronic
962117292 3:132524481-132524503 AGCAGCTGCCTCTGAGGCAGAGG + Intronic
963229973 3:142899638-142899660 AGGGGCTGTCTGTGAGGAACAGG - Intergenic
963230956 3:142908561-142908583 AAGAGCTGCATCTGGGTAATGGG - Intergenic
964295476 3:155228341-155228363 AGGAGCTTCCTCTATGTAACTGG + Intergenic
964736649 3:159925068-159925090 AGGAGCTTCCTCTAGGGCAGTGG - Intergenic
965683580 3:171277418-171277440 AGTAGTTGCTTTTGGGGAACAGG + Intronic
966057432 3:175712674-175712696 AGGTTCTGTCTGTGGGGAACAGG + Intronic
966371989 3:179260332-179260354 AGGTGCTACCTATGAGGAACAGG - Intronic
966743886 3:183257695-183257717 AGGAACTGCCACTGGGCAACAGG + Intronic
967038196 3:185663989-185664011 AGGTGCTCCCTCTGGGCACCAGG + Intronic
967068745 3:185943588-185943610 AGCAGCTGCCTCTAGAGCACCGG + Intergenic
967815896 3:193797874-193797896 AGGAGCTGTCTGTAGGGCACAGG + Intergenic
968072953 3:195798902-195798924 AAGAGCTGGCTCAGGGGGACTGG + Intronic
968579232 4:1382134-1382156 AGCTGCTGCCTCTGGGCATCAGG - Intronic
968633313 4:1664048-1664070 AGGAGCACCCTATGGGGAAAAGG + Intronic
968954444 4:3711054-3711076 AGGAGCTGCAGCTGAGGAGCTGG - Intergenic
969220046 4:5753404-5753426 ATGAGCTGCCGCTGGGCGACAGG - Intronic
969451155 4:7274197-7274219 AGCATCTGCCTATGGGGAAAGGG - Intronic
969764820 4:9220348-9220370 AGAAGCTTCCTCTGAGTAACAGG + Exonic
969770297 4:9263068-9263090 AGAAGCTTCCTCTGAGTAACAGG + Exonic
970195733 4:13548164-13548186 TGGACCTGGCTCTGGGGAGCCGG - Intergenic
972646368 4:40971484-40971506 AGGAGCTTTCTCTGGGAAAATGG + Intronic
981040865 4:140220229-140220251 AGCAGCTGTCTTTGGGGAACGGG + Intergenic
981695964 4:147559054-147559076 AGTGGTTGCCTCAGGGGAACAGG + Intergenic
982910000 4:161128067-161128089 ATGAGCTGCCTCTGGGGTGTTGG + Intergenic
984256703 4:177398205-177398227 GGGAGCTGCCTCTGGAGCAAAGG - Intergenic
985145918 4:186894430-186894452 AGTGGCTGCTTCTGGGGAAGTGG - Intergenic
985649566 5:1101123-1101145 AGGAGGGGCCTCTGGGGAGAGGG - Intronic
987050760 5:14144767-14144789 AGGCGCCGCCGCTGGGGTACCGG - Intronic
988364259 5:30275789-30275811 ATGAGGTGATTCTGGGGAACTGG + Intergenic
988439275 5:31213662-31213684 GGCAGATGCCTCTGGGAAACGGG + Intronic
988966186 5:36420488-36420510 AGCAGTTGCATCTGGGGAACTGG - Intergenic
989566927 5:42910190-42910212 AGGAGCTCCTTCCGGGGAATTGG + Intergenic
992141144 5:73798471-73798493 CGGAGCTGGTTCTGGGGCACCGG - Intronic
992151577 5:73909698-73909720 AGGAGCTGCTGCTGCGGAGCCGG + Exonic
992277003 5:75130902-75130924 ACGAGCTCCCTCTGGGCTACCGG - Intronic
992489978 5:77233346-77233368 AGGACCTGCTCCTGGGGAAGGGG - Intronic
992662584 5:78976146-78976168 AGGAGCTGCCTATGGGAAGGAGG + Intronic
994726819 5:103445882-103445904 AGGAGATGTCCTTGGGGAACTGG + Intergenic
996221429 5:120937091-120937113 AGGAGCTCCCTCTGGGCTGCTGG + Intergenic
997292380 5:132747335-132747357 TGGAGCTACCTCTGGCGCACCGG - Intergenic
998494960 5:142580528-142580550 AGTAGTTGCCTCTGGGGAGCAGG + Intergenic
999239296 5:150118262-150118284 AGGAGCTGCCTCTGTGTCAAAGG + Intronic
999733986 5:154498895-154498917 AGGAGATGCCTTTGGGGCAGAGG - Intergenic
1000451030 5:161387013-161387035 ACTGGCTACCTCTGGGGAACGGG + Intronic
1001570256 5:172726050-172726072 AGGCCCTGCGGCTGGGGAACTGG - Intergenic
1001907638 5:175486282-175486304 AGGAGCAGCCTCCAGGGCACTGG - Intronic
1002173368 5:177387653-177387675 AGGAGCGGCCACTGGGGACTGGG + Intronic
1002175098 5:177397109-177397131 TGGAGCTGCCTCTGGGGTGTGGG + Intronic
1002519457 5:179783168-179783190 ATGAGCTGCCTGGGGGGAGCAGG + Intronic
1002524468 5:179807367-179807389 AGGAGCTTCCTCTGGGCCTCTGG + Intronic
1003023130 6:2529422-2529444 AGCACCTGCCTCTGGGGTGCTGG + Intergenic
1003269294 6:4593146-4593168 AGGGCCTGGCTCTGGGGCACAGG + Intergenic
1003474056 6:6465191-6465213 AAGACCTGCCACTGGAGAACAGG + Intergenic
1003511940 6:6789004-6789026 AGTGGCTGCCTCTGGGGAGCAGG + Intergenic
1004606623 6:17200854-17200876 AGGAGCTTCCTCTGGGCTGCCGG + Intergenic
1005415535 6:25596472-25596494 ATTAGTTGCCTCTGGGGAATAGG - Intronic
1008565730 6:52766251-52766273 AGGAGCTGCCTCTTGAGGACTGG + Intergenic
1008569914 6:52806587-52806609 AGGAGCTGCCTCTTGAGGACTGG + Intergenic
1009971268 6:70627929-70627951 AGGAGCTCCCTCTGGGCTGCCGG - Intergenic
1012468312 6:99540284-99540306 AGTGGCTGCCTCTGGAGAATGGG + Intergenic
1015439692 6:133233625-133233647 ATGAGCTGCATCTGGGTAGCAGG + Intergenic
1015684648 6:135846384-135846406 AGCAGTTGCCTCTAGGAAACAGG + Intergenic
1016037886 6:139401941-139401963 AGGAGCTGTTTCTGGGGTGCTGG + Intergenic
1016184688 6:141183649-141183671 ATGAGCTCCCTCTGGGCTACTGG + Intergenic
1018790914 6:167147032-167147054 AATCGCTGCCTCTGGGGAACTGG + Intronic
1018906292 6:168078285-168078307 AGGAGCTGCTCCTTGGAAACCGG + Intronic
1019321696 7:418971-418993 CGGAGTTGCCTCTGGCCAACTGG - Intergenic
1019327844 7:446896-446918 AGGAGCTGCCTCCCGAGGACTGG + Intergenic
1019389250 7:776539-776561 TGGAGCTGCCTGTGGGGAGACGG + Intronic
1019715802 7:2538754-2538776 AGGAACAGGCTCTGGGGGACAGG + Exonic
1020015549 7:4829335-4829357 GGGACCTGGCTCTGGGGAGCGGG + Intronic
1020412619 7:7909865-7909887 TGAAGCTTCCTCTGGGAAACTGG + Intronic
1021022018 7:15612530-15612552 AGGAGCTGCGGCTCGGGAAAAGG - Exonic
1021639681 7:22725298-22725320 AGGTGCTACCTCTGGGAAAAGGG + Intergenic
1021893872 7:25214960-25214982 AGTAGTTGCTTCTGGGGAAGAGG + Intergenic
1022108466 7:27213473-27213495 AGGAGTTGAGTCTGGGGAGCAGG - Intergenic
1022478714 7:30728916-30728938 AGGCTCTGCTTCTAGGGAACTGG + Intronic
1022970536 7:35512997-35513019 AGAGGCTGCCTCTGGGGAGGGGG + Intergenic
1023855091 7:44178051-44178073 AGGCCCTGCCTGTGGGGAGCGGG + Intronic
1024261714 7:47578468-47578490 GGGAGTTGCCTCTGCGAAACAGG - Intronic
1024506667 7:50167808-50167830 AAGGGGTGCCTCTGGGGAAAAGG - Intergenic
1025144045 7:56489685-56489707 TGGAGCTGCCTCTGCTGACCAGG - Intergenic
1025195191 7:56927073-56927095 AGGAGCCGCCACTGTGGACCAGG + Intergenic
1025641610 7:63377988-63378010 AGGAGCTTCCCCTGAGAAACGGG + Intergenic
1025676761 7:63649870-63649892 AGGAGCCGCCACTGTGGACCAGG - Intergenic
1028135141 7:87217372-87217394 AGTTGCTGCCTCTGTGGAAATGG + Intronic
1029351402 7:100015663-100015685 GGGAGCTGACTCTGGGGCTCAGG - Exonic
1030624421 7:111828961-111828983 AGCAGCTACCTCTGGGGATTAGG + Intronic
1030886854 7:114949345-114949367 AGGAGCTGAGGCTTGGGAACTGG + Intronic
1031807535 7:126326604-126326626 ATGAGCTACTTCTTGGGAACTGG + Intergenic
1033451174 7:141463553-141463575 AGGAGCTGCCACTGGGAAGGAGG - Intronic
1033789571 7:144775441-144775463 AAGATCTGCATCTGGGGCACTGG - Intronic
1034285230 7:149879596-149879618 AGGAGATGCTGCTGGGGAGCTGG + Exonic
1034531154 7:151697170-151697192 AAGAGCAGCTGCTGGGGAACGGG + Intronic
1036165462 8:6428841-6428863 AGGAGCTGCCTCTGGGGAACAGG - Intronic
1037321181 8:17644830-17644852 ATGAGCTGGCTCTGGGGCTCTGG + Exonic
1038161827 8:25046796-25046818 AGGTGCTGTCTGTGAGGAACAGG + Intergenic
1038234905 8:25743332-25743354 AGTGGTTGCCTCTGGGGAAGAGG - Intergenic
1039545115 8:38404381-38404403 AGGTCCTGCCACTGGAGAACGGG - Exonic
1039919444 8:41882942-41882964 AGCACCTGCCTCAGGTGAACAGG - Intronic
1040814280 8:51491364-51491386 AGAAGCTGCCTCTGGAGAGAGGG + Intronic
1042188237 8:66158109-66158131 AGCAGCTGCCTCAGGGTAAGAGG + Intronic
1043224086 8:77700959-77700981 AGGAGCTCCCTCTGGGCTGCTGG + Intergenic
1043463064 8:80480080-80480102 AGGTGCTGTCTATGAGGAACAGG - Intergenic
1043784347 8:84379025-84379047 TGGAGCTGCATCTGAGAAACAGG - Intronic
1044831752 8:96256762-96256784 AGTAGATGCATCTGGGGAATAGG + Intronic
1045210778 8:100097139-100097161 AGCAGGTGTCTCTGGGGAATGGG + Intronic
1047289088 8:123513482-123513504 AGGCACTGCCTCTGGGGATATGG + Intronic
1048891659 8:138953831-138953853 AGGAGCTGCCCCTGGGAGAGTGG + Intergenic
1049369457 8:142256902-142256924 AGGGGCTGCCTCAGGGGTCCTGG + Intronic
1051819691 9:21149976-21149998 TGGAGCAGCTTCTGGGGAAGGGG - Intergenic
1051935849 9:22441162-22441184 ATGAGCTCCCTCTGGGGTGCCGG + Intergenic
1052715790 9:32115355-32115377 AGCAGCTGCCTCTGGGGCTTGGG - Intergenic
1053527017 9:38840532-38840554 AGGAGCACCCTCCAGGGAACAGG + Intergenic
1054199243 9:62064963-62064985 AGGAGCACCCTCCAGGGAACAGG + Intergenic
1054639113 9:67523394-67523416 AGGAGCACCCTCCAGGGAACAGG - Intergenic
1055564959 9:77559235-77559257 AGGAGATGCCTCTGGGAAGTTGG - Intronic
1057212306 9:93206787-93206809 AAGAGCTGCCTCGGGGAAGCAGG - Intronic
1057444714 9:95105318-95105340 AGGAGGGGCCTCTGGGGACTGGG + Intronic
1057526948 9:95811293-95811315 AGGAGCTGCCTCTGGGTCTCTGG - Intergenic
1057693769 9:97309591-97309613 AGGACCTACCTGTGGAGAACAGG - Exonic
1058672059 9:107368011-107368033 AGAGGCTTCCTCTGGGGACCTGG - Intergenic
1058843540 9:108933918-108933940 GGGAGCTGACTCTGGGTAGCCGG - Exonic
1060333109 9:122693991-122694013 AGAAGGTGCCTCTGAGGGACAGG - Intergenic
1060856638 9:126919048-126919070 AGTGGCTGCCTCTAGGGAAAAGG - Intronic
1060889488 9:127179045-127179067 TGGAGCTGCCTCTGAGGACCAGG - Intronic
1061161270 9:128895743-128895765 AGGAGCTGCCTCTGCTGCTCCGG + Intronic
1061525935 9:131162454-131162476 AGTAGCTGCCTCTGGGAAGTAGG - Intronic
1061608652 9:131730936-131730958 AGCAGCTGCCTCTGTGGCAGAGG + Intronic
1062016882 9:134295547-134295569 GGCAGCGTCCTCTGGGGAACGGG + Intergenic
1062067523 9:134536691-134536713 AGGGGTTGCTTCTGGGGAAACGG + Intergenic
1062452950 9:136623175-136623197 AGGAGCTGCCTGGTGGGAACCGG - Intergenic
1187269687 X:17768592-17768614 TGGTGATGCCTCTGGGAAACAGG + Intergenic
1187276059 X:17817531-17817553 GGGAGCTGCCTCCAGGGAGCAGG + Intronic
1187335678 X:18379302-18379324 AGGAGTTACCTCTGGGGAGGAGG + Intergenic
1187912668 X:24125166-24125188 AGGAGCTGCCTTGGGGGATGAGG + Intergenic
1189068946 X:37844349-37844371 ATGAGTTTCCTCTGGGGAATGGG - Intronic
1189296572 X:39922682-39922704 AGGAGCTGCCTATGCTGACCAGG + Intergenic
1189341010 X:40204554-40204576 AGACGCTGCCTCTGGGTGACTGG + Intergenic
1190233811 X:48601227-48601249 AGGGGCTACCTCTGAGGAGCAGG + Intronic
1190742857 X:53301597-53301619 AGGAGCGGCCTAAGGGGAAGGGG + Intronic
1190751076 X:53361918-53361940 AGTAGTTGCCTCTAGGGAGCAGG + Intergenic
1195273465 X:103255118-103255140 AGGAGCTGCTACAGGGAAACAGG + Exonic
1196891058 X:120291383-120291405 ACTTGCTGCCTCTGGGGACCAGG + Intronic
1197109505 X:122756155-122756177 CAGAGCTGCCTGTTGGGAACAGG - Intergenic
1197882169 X:131178243-131178265 GGGAGCTGTCTCTGGGGACTAGG + Intergenic
1198839969 X:140846021-140846043 AGTGGTTGCCTCTGGCGAACAGG - Intergenic
1199762860 X:150918482-150918504 AGGAGCTGCCTCTGTAGGAAGGG + Intergenic
1200837824 Y:7750162-7750184 AGCAGGTACCCCTGGGGAACAGG + Intergenic