ID: 1036165577

View in Genome Browser
Species Human (GRCh38)
Location 8:6429669-6429691
Sequence TGACCTCTGGTTAAATCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036165577_1036165582 19 Left 1036165577 8:6429669-6429691 CCACCAGATTTAACCAGAGGTCA 0: 1
1: 0
2: 0
3: 13
4: 147
Right 1036165582 8:6429711-6429733 GTCTAAATATTATTCAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036165577 Original CRISPR TGACCTCTGGTTAAATCTGG TGG (reversed) Intronic
907035395 1:51211865-51211887 TGACCTCAGGCTAATTTTGGGGG + Intergenic
907620495 1:55973043-55973065 TGACCTCAGGCTAAACATGGTGG + Intergenic
909247547 1:73306507-73306529 TGACATCTGGTAAAATCAAGGGG - Intergenic
909305151 1:74065543-74065565 TGACCTCACGTTAACTATGGAGG - Intronic
912489446 1:110053849-110053871 TGACCTCTGGTTAGAAAGGGAGG + Exonic
919301020 1:195766007-195766029 TGACCTCTGATAAAATATGGGGG + Intergenic
920598397 1:207296710-207296732 TGACCACTTTTTAAATCTGGTGG - Intergenic
923567329 1:235085996-235086018 TGACCTCAGGTCAACTCTGTGGG - Intergenic
923667731 1:236013805-236013827 TGACCTCAGTTTCACTCTGGGGG + Intronic
924870046 1:248032159-248032181 TGACCTCTGGTTATTTGTGAGGG - Intronic
1062895105 10:1097357-1097379 TCCCCTCTGGTTCAAGCTGGCGG - Intronic
1064835423 10:19523238-19523260 TGTCCACTGGTTAAGTCTGAAGG - Intronic
1065814431 10:29471243-29471265 TTACCTCTGTTTAAATCGGAAGG - Exonic
1069783995 10:70976590-70976612 AGAACTCTGGTTGAATATGGAGG + Intergenic
1072432190 10:95382845-95382867 TGATATATGGTTAAATCTGCAGG + Intronic
1073499264 10:103921113-103921135 TGACCTCTCTATAAATCTGAAGG + Intergenic
1073633860 10:105177353-105177375 TGCCCCCTGGTTAAATCAAGGGG + Intronic
1077511889 11:2970386-2970408 TGACCTCTTGTTAAAATTTGTGG + Intronic
1078907603 11:15702378-15702400 TGGCAACTGGTAAAATCTGGAGG - Intergenic
1079440434 11:20508643-20508665 TTACATTTGGTTAAATCTGGTGG - Exonic
1083470607 11:62881474-62881496 GTACCTCCGGTTGAATCTGGTGG + Intronic
1084494097 11:69494188-69494210 TGGCCTCTGCTTAGACCTGGCGG - Intergenic
1089427091 11:118386939-118386961 TGAATCCTGGTTAAATATGGTGG + Intronic
1089689531 11:120178698-120178720 AGTCCTCTGGGCAAATCTGGAGG - Intronic
1090335654 11:125961720-125961742 TGACCTCTGCTGAACTCTGCTGG + Exonic
1095633164 12:44401379-44401401 TGACCTCTGGAAAAAGCAGGTGG + Intergenic
1100473347 12:94913353-94913375 TGTCCTCAGGTTAGACCTGGGGG + Intronic
1101674387 12:106904180-106904202 TGACATCTGCATAAATTTGGCGG + Intergenic
1101818306 12:108162748-108162770 TGACCTCTGCTCAGACCTGGAGG + Intronic
1101848512 12:108383306-108383328 TGACCTCTGGTTAGAAATAGGGG - Intergenic
1108527545 13:51298909-51298931 TGACCTCCTGGTAAATGTGGTGG - Intergenic
1112864203 13:103873100-103873122 TGACCTATGGTTATATGTGTGGG - Intergenic
1114148452 14:20007175-20007197 TGTCCTCTGGTTAAAGATAGTGG - Intergenic
1117873047 14:60220764-60220786 TGACATCTTGTAAAATCTGGAGG + Intergenic
1120811029 14:88803636-88803658 TGAACACTGATTAATTCTGGAGG - Intergenic
1120994903 14:90409652-90409674 TGAACTCTGATTAAATCAAGTGG + Intergenic
1121526119 14:94620710-94620732 TGAGTTCTGGATAAATCTGAGGG + Intronic
1121852421 14:97233923-97233945 TGACCTCTGTTTAAATATTTTGG - Intergenic
1123989729 15:25674432-25674454 TGACGTCTGGTTAACTCAGACGG + Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1128957759 15:71966571-71966593 TGACCTCTGGCTAGAGCTGATGG - Intronic
1131503502 15:92994113-92994135 TGAGCTGTGGTTAAATCTTCAGG + Intronic
1131523686 15:93136026-93136048 TGACCTCTGGTAAAACCAGCAGG - Intergenic
1133199995 16:4198209-4198231 GGTCTCCTGGTTAAATCTGGAGG + Intronic
1136296634 16:29307757-29307779 TGGCCTTTGGGTAACTCTGGTGG + Intergenic
1140299551 16:73743011-73743033 TAACCTCTGGTTATCTCTGAAGG - Intergenic
1142155394 16:88530628-88530650 TGACCACAGGCCAAATCTGGTGG - Intronic
1146519106 17:33512584-33512606 TGGTCTCTTTTTAAATCTGGTGG - Intronic
1147646389 17:42036823-42036845 GGACCTCTGTCTAACTCTGGAGG + Intronic
1148078034 17:44950732-44950754 TGACCTCTTGTTAAACCAAGTGG - Intergenic
1148588877 17:48800692-48800714 TGACCTAGGGTGCAATCTGGTGG - Intronic
1153270903 18:3320182-3320204 TGCCCTCTGCTTACATCTGTTGG - Intergenic
1153877185 18:9384457-9384479 TGACTTCTGGTTCAATATGATGG + Intronic
1155454721 18:25998814-25998836 TGACCTCTGCATAAATGTTGGGG + Intergenic
1158521463 18:58174729-58174751 TGATCCCTGGGTAAATGTGGGGG + Intronic
1158888126 18:61848457-61848479 TGACTTCTGGTTTTATCTGGGGG - Intronic
1161745574 19:6057675-6057697 TGAACTCTGGTACCATCTGGAGG - Intronic
1164716818 19:30397395-30397417 TGAAGTCTGGGTAAAGCTGGAGG + Intronic
1165163314 19:33831677-33831699 TTACATCTGGTAAAACCTGGAGG + Intergenic
1165381687 19:35486058-35486080 TGCTCTCTGGTTGAAACTGGGGG + Intergenic
1167003061 19:46757131-46757153 TGACCATTTGATAAATCTGGAGG - Exonic
1167671076 19:50854103-50854125 TGACCTGTCGTTTAATCTTGAGG + Intergenic
1168682954 19:58329198-58329220 TGACCGCTGGTGACCTCTGGTGG - Intronic
925282428 2:2694116-2694138 GGACTTCTGGTTAAACATGGCGG + Intergenic
925306686 2:2851662-2851684 TGACCCCTGGTTCAAGCAGGTGG - Intergenic
925417627 2:3682261-3682283 TGACCTCTGGGGAAATCTGCTGG - Intronic
925522870 2:4767258-4767280 TGACCTCTGGCCAAACATGGAGG - Intergenic
926261808 2:11271150-11271172 TATGCTCTGGTTACATCTGGAGG + Intronic
926752381 2:16208389-16208411 TGAGCTCTGGATAAATCCGTGGG + Intergenic
927257612 2:21053881-21053903 TGACCCCTGGGCAAAGCTGGAGG + Intergenic
929129197 2:38549764-38549786 TGACCTCTAGATAAATGTTGTGG - Intergenic
929364169 2:41131908-41131930 TGCAGTCTGGTTCAATCTGGTGG + Intergenic
930463228 2:51710507-51710529 TGACCTCTAGTGACCTCTGGAGG + Intergenic
931835642 2:66096011-66096033 TGACTTCAGGTTAACCCTGGTGG - Intergenic
931979233 2:67676851-67676873 TGACCTCTGTTCAACTCTGGTGG - Intergenic
934519841 2:95013257-95013279 TGACATCTGGTGAAACCGGGAGG + Intergenic
934535668 2:95131199-95131221 TGACATCTGGTGAAATCAGGAGG + Intronic
938170488 2:129071317-129071339 TGAGGTCTGATTAAATTTGGTGG - Intergenic
938559887 2:132462497-132462519 TGACATCTGGTAAAATCAGGAGG - Intronic
943138594 2:183948980-183949002 TGACATCTGCTTACATCTGTTGG + Intergenic
943321360 2:186447270-186447292 TCACCAGTGGTTCAATCTGGAGG + Intergenic
943672744 2:190680797-190680819 TTTACTCTGATTAAATCTGGTGG + Intronic
948213380 2:236211283-236211305 TGACCGCTAGTTAACACTGGGGG - Intronic
948269190 2:236661222-236661244 AGAACTGTGGTTAAATCTGCAGG + Intergenic
948350820 2:237339530-237339552 TGACCTGTGGGTGAACCTGGGGG + Intronic
1169133224 20:3178504-3178526 TGACTTCTGGTAAAATCAAGAGG - Intergenic
1170130446 20:13013400-13013422 TGACCTCTATTTCAATCAGGGGG - Intronic
1170210859 20:13845207-13845229 TGACCTCTGTTTAACACAGGAGG - Intergenic
1170592556 20:17781942-17781964 TGACCCCTGCTGAAATCTGGGGG + Intergenic
1170620378 20:17990760-17990782 TGGCCTCTGGCTACTTCTGGGGG - Exonic
1171480789 20:25454392-25454414 TGACTTCTGGTTCAATCCTGTGG - Intronic
1174093245 20:48066828-48066850 TGACTTCAGGTTGACTCTGGAGG + Intergenic
1176052255 20:63126070-63126092 CGACCTTTGGTTGAAGCTGGGGG + Intergenic
1178077209 21:29023324-29023346 TAACATTTGGTTAAATTTGGGGG - Intergenic
1181496530 22:23290390-23290412 TGAACTCTGCTTAAATCCAGTGG - Exonic
1181815586 22:25434213-25434235 TGTGTTCCGGTTAAATCTGGGGG - Intergenic
1182905967 22:33936600-33936622 TGACCTTTGATAAAATGTGGAGG - Intergenic
950978305 3:17274243-17274265 TGACCTCTGATTAAACAAGGAGG - Intronic
952561811 3:34603886-34603908 TGACCTGTGGTAACATCTAGGGG - Intergenic
957356421 3:79093825-79093847 TGTCCACTTCTTAAATCTGGTGG - Intronic
959056811 3:101574898-101574920 TGCCCTCTGGTTTAAGCTGCGGG + Intronic
959117478 3:102195165-102195187 TGACTTCTTGTAAAGTCTGGAGG + Intronic
962682485 3:137814814-137814836 TGGCCTCTGGTCAGAGCTGGAGG - Intergenic
962840072 3:139225340-139225362 TCACCTCTGGTTAACCCTGTTGG + Intronic
962957499 3:140279638-140279660 TGACGTCTGCTTAACTGTGGTGG + Intronic
964657083 3:159079222-159079244 TGAACTCTGTTTTAAACTGGGGG - Intronic
973108383 4:46369194-46369216 AGATCTCTGGCTAAATCTAGAGG + Intronic
973189870 4:47374566-47374588 TGACATATGGTGAAATCAGGAGG - Intronic
978479586 4:109174274-109174296 TGACATGTGGTGAAATCAGGAGG + Intronic
978836092 4:113151088-113151110 CGGCCTCTGGTTTCATCTGGGGG - Intronic
978972130 4:114821489-114821511 TGATATCTGGTAAAATCTGAAGG + Intergenic
984777308 4:183492994-183493016 TGATATCTGGTAAAATCAGGAGG - Intergenic
988664953 5:33316308-33316330 TGGCCTCTGGTGAAATTTGTTGG - Intergenic
988788690 5:34587415-34587437 TGTCATCTTGTTAAATCTCGAGG - Intergenic
991162810 5:63524992-63525014 TTACCTCTGGTAAAATTTGGTGG - Intergenic
992297196 5:75337279-75337301 TGGCCTCTAGTGAGATCTGGAGG + Exonic
992309214 5:75477919-75477941 AGACCTGTGGGTAAATATGGTGG + Intronic
992384842 5:76274761-76274783 CTGCATCTGGTTAAATCTGGTGG + Intronic
993362239 5:86991832-86991854 TGAACTCTGCTTAAATCCAGTGG + Intergenic
993755815 5:91728292-91728314 TAAGCTCTGGTAAGATCTGGTGG - Intergenic
994184767 5:96805553-96805575 TCACCTCTGGAGCAATCTGGAGG + Intronic
994986561 5:106940979-106941001 TTACCTGTGGTTAAATCTACAGG + Intergenic
995063564 5:107837181-107837203 TGACCTCTGGGGAGATCTGGTGG - Intergenic
995966542 5:117914424-117914446 TGAGTTCTTGTGAAATCTGGTGG + Intergenic
996135849 5:119841200-119841222 GGACTTCAGGTTAAATGTGGTGG - Intergenic
996238114 5:121159171-121159193 TGACATCTAGTGAAATCAGGAGG + Intergenic
1004258324 6:14085253-14085275 TGACATCTGGTTAAATTGAGAGG - Intergenic
1006686830 6:35842171-35842193 TGACCTCTAAATAAATTTGGAGG + Intronic
1007775433 6:44222227-44222249 TGCCCTCTGGTTAGGGCTGGCGG + Intronic
1008951935 6:57171325-57171347 TGATCTCTGATTAAAGGTGGTGG + Intergenic
1010048370 6:71473812-71473834 TGACCTCTGGTAAAATTGGTGGG + Intergenic
1010495000 6:76523367-76523389 TGATATCTGGTAAAATCAGGAGG + Intergenic
1012421108 6:99066227-99066249 GGACCTGTGAGTAAATCTGGAGG + Intergenic
1013346940 6:109269796-109269818 TGACCACTGGTGAAATCTCATGG + Intergenic
1013350910 6:109304717-109304739 TGACTTCTGGCAAAATCGGGAGG - Intergenic
1013489524 6:110632311-110632333 AGACCTCTGGTTAAAAAGGGAGG - Intronic
1014318938 6:119901704-119901726 TGACCTCAGGTTGAATGTAGTGG - Intergenic
1016348832 6:143145551-143145573 AGACCTATGGTGAAATCTGCAGG - Intronic
1018848363 6:167570770-167570792 TGACCTCTGATGGAGTCTGGTGG - Intergenic
1018972303 6:168538001-168538023 TGAGCTCTGCTGGAATCTGGGGG + Intronic
1018972344 6:168538153-168538175 TGACCCCTGCTGGAATCTGGGGG + Intronic
1018972365 6:168538212-168538234 TGACCGCTGCTGGAATCTGGGGG + Intronic
1018972549 6:168538811-168538833 TGACCCCTGCTGGAATCTGGGGG + Intronic
1036165577 8:6429669-6429691 TGACCTCTGGTTAAATCTGGTGG - Intronic
1037670237 8:21009132-21009154 TGACCTCTGAGTAAGTGTGGTGG + Intergenic
1037886040 8:22597007-22597029 TCACCTCTGGTCACAACTGGAGG + Intronic
1037948112 8:23001938-23001960 TGACCACTGCTTAACTCTAGAGG + Intronic
1038803667 8:30771537-30771559 TGACTTCTGGTTAATTCTGTTGG - Intergenic
1045993515 8:108337624-108337646 TAAACTCTGGTCAAATCTGAGGG - Intronic
1047445296 8:124913889-124913911 TTACCTCTAGATAGATCTGGAGG - Intergenic
1050690476 9:8221960-8221982 TGACATCTGGTAAAATCAGTAGG + Intergenic
1053309154 9:37004748-37004770 TGAGCTTTGGTTATATATGGTGG - Intronic
1057707414 9:97406098-97406120 TGACCTTTCGTTAAATTGGGAGG - Intergenic
1058184746 9:101841114-101841136 TGACATCTGGTGAAATCAGAAGG - Intergenic
1058337838 9:103854985-103855007 TAATTTCTGGTTAAATGTGGTGG - Intergenic
1058651803 9:107181890-107181912 AGCCCTCTGGGTAAATGTGGTGG - Intergenic
1058933117 9:109741613-109741635 TGACATTTGGTTATGTCTGGTGG + Intronic
1190550552 X:51575710-51575732 TGACATCTGGTGAAATTTAGAGG + Intergenic
1190557739 X:51653417-51653439 TGACTTCTTGTAAGATCTGGAGG - Intergenic
1192212651 X:69137449-69137471 TGACCTCTGGGTAACTTGGGAGG - Intergenic
1202051569 Y:20786568-20786590 TGAAATATGGATAAATCTGGAGG - Intergenic