ID: 1036168460

View in Genome Browser
Species Human (GRCh38)
Location 8:6459784-6459806
Sequence GACTGACAGTCCTGTCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036168460_1036168462 17 Left 1036168460 8:6459784-6459806 CCCTGCAGACAGGACTGTCAGTC 0: 1
1: 0
2: 0
3: 23
4: 183
Right 1036168462 8:6459824-6459846 GTGAGTTCTGAGTAATGTGAAGG No data
1036168460_1036168463 24 Left 1036168460 8:6459784-6459806 CCCTGCAGACAGGACTGTCAGTC 0: 1
1: 0
2: 0
3: 23
4: 183
Right 1036168463 8:6459831-6459853 CTGAGTAATGTGAAGGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036168460 Original CRISPR GACTGACAGTCCTGTCTGCA GGG (reversed) Intronic
905104924 1:35558504-35558526 GACTGAGAGCCCTGGCTGGAGGG + Intronic
905281172 1:36850273-36850295 GTCGGACAGTCCTTCCTGCAGGG + Intronic
906141063 1:43533720-43533742 GACTGACACTGCTGTGTGCTTGG + Intronic
906698451 1:47840566-47840588 TAATGACAGGCCTGTCTTCAGGG + Intronic
908124403 1:61015764-61015786 GACTGACAGTTCTATCAGAACGG + Intronic
911947743 1:104134541-104134563 GCCTGACATTCCTGGTTGCAGGG - Intergenic
912582774 1:110735328-110735350 GACTGACAGTGCTGGGTGCCGGG + Intergenic
913326785 1:117634786-117634808 GACTGCCAGTCCTGTGAGCTGGG + Intergenic
915368066 1:155326409-155326431 GACTGACATCCCCGCCTGCATGG - Intronic
915424534 1:155813645-155813667 GGCTTCCAGTCCAGTCTGCATGG - Exonic
919647646 1:200111550-200111572 GACTGAAAGTCCTGCTTACAAGG + Intronic
1064738035 10:18403151-18403173 GACTGACAGTCTTCTCTGAAAGG + Intronic
1065170246 10:23019836-23019858 GACTAACAGGCGTGGCTGCATGG - Intronic
1066343261 10:34557074-34557096 GGTTGACATTCCTCTCTGCAGGG - Intronic
1068877124 10:62008842-62008864 TAATGAAAGTCCTGTCAGCATGG - Intronic
1070946256 10:80394383-80394405 GAATGCCAGACCTCTCTGCAGGG - Intergenic
1073452199 10:103616666-103616688 GACTGGCTGTCCAATCTGCAGGG - Intronic
1076918735 10:133440523-133440545 GACTGTCAGTCCTGCTGGCAAGG - Intergenic
1078266884 11:9761587-9761609 GAATGTCAGTGCTCTCTGCAAGG - Intergenic
1078922952 11:15847412-15847434 GACTTACAGGCATGTCTTCACGG + Intergenic
1079271147 11:18987166-18987188 GACTGGCATTTCTGGCTGCATGG - Intergenic
1079322516 11:19463468-19463490 GCCTGGCAGTGCTGTCTGAATGG - Intronic
1082190006 11:49231764-49231786 GACCCACAGTCATGTCTGCCTGG - Intergenic
1083632664 11:64103829-64103851 GAGTGAGGGTCCTGTGTGCAAGG - Exonic
1083871840 11:65493168-65493190 AAGTGACAGGCCTGTCTGCTGGG + Intergenic
1084275548 11:68049409-68049431 CTCTGACGGCCCTGTCTGCACGG - Intronic
1085319822 11:75567087-75567109 GAGTGACAGTCCTGCCTCCCTGG - Intronic
1085709666 11:78817704-78817726 GAGAGACAGTCCTGCCTGCAGGG + Intronic
1088153510 11:106776849-106776871 TACTGACAGTCCTGTTTTCGTGG - Intronic
1088953323 11:114591821-114591843 GACTGACAGCCCTTGATGCAAGG + Intronic
1090682595 11:129077475-129077497 GACTGGCCTTCCTGGCTGCATGG + Intronic
1091480611 12:826327-826349 GTCTAACAGACCTTTCTGCAAGG - Intronic
1092644559 12:10555227-10555249 CACTGAGAGTCCTAGCTGCAAGG - Intergenic
1095759226 12:45809532-45809554 GACTGTAAATTCTGTCTGCAAGG + Intronic
1096785203 12:54013311-54013333 AACTGGCTGGCCTGTCTGCAGGG + Intronic
1096976000 12:55699571-55699593 GAAGGACAGTCCTGTCTTCTAGG - Intronic
1097556971 12:61150320-61150342 GACTGACAGCCCTTGCCGCAAGG + Intergenic
1101910654 12:108857938-108857960 GCTGTACAGTCCTGTCTGCACGG - Intergenic
1104063044 12:125284059-125284081 GACTGACAGCCCTGTTTCCTAGG + Intronic
1104440087 12:128787113-128787135 GACCGAGAGTCCTTTCTGGAGGG - Intergenic
1105747548 13:23392021-23392043 GACTGACTTTCCTGTCTCCCAGG + Intronic
1105970258 13:25422967-25422989 GAATGACAGCCCTCTCTTCATGG + Intronic
1106952272 13:34897552-34897574 GTCTGAAATTCCTGTCTTCAAGG - Intergenic
1109337803 13:61014857-61014879 GACTTACACTCCTCTCTGCAAGG - Intergenic
1111608308 13:90569228-90569250 GACTGACAGTTCTGTATGATTGG - Intergenic
1111923746 13:94440896-94440918 GTCTGAAACTCCTGACTGCAGGG + Intronic
1113954494 13:114089929-114089951 CACTGAACGTCCTGTCTTCAAGG + Intronic
1115775407 14:36709502-36709524 GACTGACAATTCTGACTCCAGGG - Intronic
1117443155 14:55778804-55778826 GACTAACAGCCCTTCCTGCAAGG + Intergenic
1118729805 14:68658340-68658362 CACTGACAGACCTGTCCTCATGG + Intronic
1122089574 14:99329281-99329303 GACTCACAGTTCTGTCTGGCTGG - Intergenic
1122539569 14:102490398-102490420 GCCTGGCAGTCCTGCCTGCTGGG - Intronic
1130084351 15:80764721-80764743 GTCTCACAGACCTATCTGCAGGG - Intergenic
1132473132 16:117984-118006 GACTGCCACTCCTGTCTACAGGG + Intronic
1132499473 16:278945-278967 GTCTGGCTGCCCTGTCTGCAGGG + Intronic
1134142755 16:11735963-11735985 GACTGTCAGTCCTATATGTAGGG - Intronic
1135168988 16:20166249-20166271 GACTCAGAGTCATGTTTGCAAGG - Intergenic
1137764834 16:50970066-50970088 GACTGGCAGAGGTGTCTGCAGGG + Intergenic
1138207769 16:55137439-55137461 GACTCACAGTTCTGCCTGGATGG + Intergenic
1151702903 17:75752852-75752874 GCCTGAGTGTCCTGTGTGCATGG - Intronic
1151980005 17:77503076-77503098 CACTGAAAGTCCTGTGTGCTTGG - Intergenic
1152409425 17:80115295-80115317 GTCTGACTGCCCTGTCTTCAAGG + Intergenic
1152514644 17:80816256-80816278 GCCTGGCAGGCCTGGCTGCAGGG + Intronic
1153021038 18:629440-629462 TACTGACAGTCCTGTGCACATGG - Intronic
1154176645 18:12090401-12090423 GATAGAGAGTCCTTTCTGCATGG + Intergenic
1158829274 18:61260073-61260095 GCCTGACAGTCCTCCCTGCCAGG + Intergenic
1158879217 18:61760492-61760514 GACTCACAGTTCTGCCTGGATGG - Intergenic
1159903718 18:74071913-74071935 GACTGCTAGTCCTGTGAGCAGGG - Intergenic
1160448720 18:78947325-78947347 GTCAGACAGTCCTGTGTGCCAGG + Intergenic
1160455866 18:78999528-78999550 GACTGACCCTCCTGTGTGCAGGG + Exonic
1163051896 19:14690353-14690375 GGATGACAGCCCTGTCTGCCCGG - Intronic
1166052147 19:40266613-40266635 GTCTGGCAGTCCTGTGTGCTTGG - Intronic
1166564002 19:43752548-43752570 GACAGACAATACAGTCTGCAGGG + Intronic
1166750931 19:45163720-45163742 GCCAGACAGTTCTCTCTGCAGGG + Intronic
1168337243 19:55603592-55603614 GACCTACAGTCAGGTCTGCATGG - Intergenic
924987227 2:283119-283141 GGCTGTCAGTCCAGTGTGCATGG - Exonic
925358303 2:3258892-3258914 TACAGACAGTTCTGTCTACAAGG + Intronic
926379922 2:12276807-12276829 ATCTGACAGTCCTTTCTACAGGG + Intergenic
932085090 2:68750736-68750758 CACAGACAGTCCGGTCTGCAGGG - Intronic
932198878 2:69808365-69808387 GACGTACAGTCCAGTCTGAAGGG - Intronic
938238787 2:129727000-129727022 TACTGACATTCCTGTCTCCCTGG + Intergenic
943357223 2:186871347-186871369 GACTGACAGTTTTCTCAGCAAGG - Intergenic
943487401 2:188503321-188503343 GACTCACAGTTCTGTATGGATGG + Intronic
947282375 2:228469696-228469718 GCCTGACATTCCTGTTGGCAGGG + Intergenic
947715048 2:232335139-232335161 GACTCACAGTTCTCTCTCCAAGG + Intronic
947734123 2:232446090-232446112 GACTCACAGTTCTCTCTCCAAGG + Intergenic
948444543 2:238021999-238022021 AACTGGCATTCCTCTCTGCAAGG - Intronic
948908469 2:240991263-240991285 GGCTCACTGTCCTGTCTGGAAGG - Intronic
1170505674 20:17023522-17023544 GAGAGACAGTCCTGTCTTCTGGG + Intergenic
1171348140 20:24481668-24481690 GTCTGACCTACCTGTCTGCATGG - Intronic
1172242701 20:33423805-33423827 GACTGAATGTCCTGGCTGAAGGG + Intronic
1173253065 20:41374797-41374819 GACTGGCAGTCCTGGATGCGGGG + Intergenic
1174821557 20:53730821-53730843 TACTGAAAGTCCTGTGTCCAAGG + Intergenic
1175488003 20:59359194-59359216 GAATGACAGTACTGACTTCAAGG + Intergenic
1175638340 20:60604113-60604135 AATTGAGTGTCCTGTCTGCAAGG + Intergenic
1176307296 21:5130436-5130458 GACTGCCAGTGCTGTCTGCCAGG - Intergenic
1179849763 21:44131594-44131616 GACTGCCAGTGCTGTCTGCCAGG + Intergenic
1180858669 22:19064272-19064294 GACTCACAGGCCTGTCCTCATGG + Intronic
1183690419 22:39384931-39384953 CACAGACTGTCCTGCCTGCACGG + Exonic
1184107691 22:42377872-42377894 AATGGACAGTCCTGTCTTCATGG - Intergenic
1184686537 22:46098905-46098927 GGGTGACACTCCTGTTTGCAAGG + Intronic
1184767866 22:46581105-46581127 TAATGACAGTCCCGTCTACAGGG + Intronic
949471081 3:4397366-4397388 AACTGTCAGTCCTGAGTGCAGGG + Intronic
949929875 3:9070303-9070325 CAGGGACAGCCCTGTCTGCAGGG - Intronic
950392888 3:12710505-12710527 GATGGACAGTTCTGGCTGCAAGG + Intergenic
951894395 3:27597175-27597197 GACTGACCCTGCTGGCTGCATGG + Intergenic
954744944 3:52782494-52782516 GAATGACAATGGTGTCTGCAGGG + Intronic
958444873 3:94202984-94203006 GACTGACCTTGCTGACTGCATGG - Intergenic
959368760 3:105496323-105496345 GACTGTTAGTCCTTTCTGAATGG - Intronic
960153195 3:114271877-114271899 GACTGACCTTGCTGGCTGCATGG - Intergenic
960954554 3:123022741-123022763 GACTGAGAGGCCATTCTGCAAGG + Intronic
961216538 3:125164621-125164643 GGATGACAGTCTTGTCTCCAGGG + Intronic
961614242 3:128166233-128166255 GTCTGTCAGCCCTCTCTGCAAGG - Intronic
962879593 3:139563707-139563729 TCCTGGCAGTCCTGTCTTCAGGG + Intronic
962947369 3:140184327-140184349 GACTTACAGTTCTGCCTGGATGG + Intronic
968590576 4:1457310-1457332 GACTCACAGTTCTGTATGCCTGG + Intergenic
969441924 4:7222345-7222367 GACTGAGTGTCCTGTTTTCAAGG - Intronic
971953620 4:33386853-33386875 GATTGACATTCCTGGCTGTAAGG + Intergenic
975427916 4:74252241-74252263 GACTGGCAGCCGTGACTGCAAGG + Intronic
976890399 4:90039690-90039712 CACTGGGAGTCCTGACTGCAGGG - Intergenic
978550551 4:109920981-109921003 GACTGAGAGTCAGGTCTGGAAGG + Intronic
981489188 4:145321693-145321715 GACTCACAGTCCTGTATGGTTGG - Intergenic
987352594 5:17034406-17034428 GACTGACAGTTCTGTATGGCTGG - Intergenic
987442202 5:17969471-17969493 GACTCACAGTCCTGCATGCCTGG + Intergenic
988602739 5:32654853-32654875 CACTGACAGTCTCGTCTCCAGGG + Intergenic
989637595 5:43553450-43553472 GACAGAAATTCCTGTCTTCATGG - Intronic
990656280 5:57960052-57960074 GACTCACAATGATGTCTGCAAGG - Intergenic
990987958 5:61658741-61658763 GACAAACAGGCCTGGCTGCAAGG - Intronic
991562693 5:67971268-67971290 GACTGGGGGTCCTATCTGCAGGG - Intergenic
994452827 5:99965356-99965378 GACTTACAGTCCTGTCTCTTAGG - Intergenic
995889401 5:116934032-116934054 GACTGAGTGGCCTGGCTGCAAGG + Intergenic
997723599 5:136101512-136101534 GACTTTCAGTGCTGACTGCATGG - Intergenic
997908016 5:137839626-137839648 GAGTGTCCGTCCTGTCTACAGGG - Intergenic
1000016216 5:157279528-157279550 GTCTGTCAGTCATGTCTGCCTGG + Intronic
1000711761 5:164588668-164588690 AACTTACAGTCCTGGCAGCAGGG + Intergenic
1001664140 5:173418692-173418714 GACTGTCCGTCATGTCTGCAGGG + Intergenic
1002921448 6:1576053-1576075 GACAGACACTCCTGGCGGCAAGG + Intergenic
1002936705 6:1680301-1680323 GACTTAGAGTCATGTCTGGATGG - Intronic
1003501237 6:6704618-6704640 GGCTGGCAGAACTGTCTGCAAGG + Intergenic
1004408029 6:15352747-15352769 GACTTACAGTCATGTCTGAGGGG - Intronic
1005996889 6:30936958-30936980 GACTGACAGACGTGTCCACAGGG + Intergenic
1006922078 6:37633735-37633757 GGCTAACAGTCCTGTGTCCAGGG - Exonic
1011564212 6:88657737-88657759 GACTGGCATTGCTGGCTGCATGG + Intronic
1011598304 6:89037323-89037345 GAATGACAGTCTAGGCTGCAAGG + Intergenic
1012273654 6:97245010-97245032 GACTGACCTTGCTGGCTGCATGG - Intronic
1016993311 6:149944079-149944101 GACTCACTGTCCTGGCTGCAGGG + Intronic
1017005022 6:150023451-150023473 GACTCACTGTCCTGGCTGCAGGG - Intronic
1018343670 6:162879704-162879726 TACTCACTGTCCTATCTGCACGG - Intronic
1033882596 7:145903441-145903463 CACTGATTGTCCTGTCTGCAAGG - Intergenic
1035018135 7:155784030-155784052 GAGTGACAGTCACGTCTGAAGGG + Intergenic
1035446793 7:158948605-158948627 GAGTGGCAGTTGTGTCTGCAGGG + Intronic
1035739553 8:1915907-1915929 GACTGACAGTCATAGCTCCAGGG - Intronic
1035889725 8:3330121-3330143 GAATGACATTTCTGTCTGCAGGG - Intronic
1036124461 8:6050142-6050164 GACTCACAGTTCTGCATGCATGG + Intergenic
1036168460 8:6459784-6459806 GACTGACAGTCCTGTCTGCAGGG - Intronic
1039171740 8:34755236-34755258 GTCTTACAGTCAGGTCTGCATGG - Intergenic
1039245956 8:35608490-35608512 CACTGAAAGCCCTGTCTTCAGGG - Intronic
1040379634 8:46859925-46859947 GAATGACAATCTTGTCTGCTAGG - Intergenic
1042668326 8:71232276-71232298 GACTGACAGTGCAGGCTGCTGGG - Intronic
1043086743 8:75844213-75844235 GACTGACAGTGCTGTCTCACAGG + Intergenic
1045944788 8:107783335-107783357 GACTCACAGTTCTGTGTGCCTGG - Intergenic
1046715885 8:117566679-117566701 GACTGTCAGTTCTGTCTCCATGG + Intergenic
1048920896 8:139229086-139229108 GAGTGGGAGTCCTGTCTGTATGG - Intergenic
1049053156 8:140215036-140215058 GGCTGACAGTGCTGTCTGTGGGG - Intronic
1049617831 8:143583611-143583633 GGCTGCCACTCCTGTCTGCCAGG - Intronic
1050611642 9:7360170-7360192 GAGTTAAAGTCCTGTCTGCCTGG - Intergenic
1050643282 9:7692160-7692182 GACTCACAGTCCTGCCTGGCTGG - Intergenic
1052122700 9:24738183-24738205 CACTGAAAGGCCTGTCTCCAGGG + Intergenic
1056623789 9:88237221-88237243 GGCTGACAGACCGGTATGCAGGG + Intergenic
1058937566 9:109783072-109783094 GACTGGGATTCCAGTCTGCAGGG + Intronic
1060404310 9:123365713-123365735 GACAGACAGCCCTGCCTTCATGG - Intronic
1062426613 9:136508943-136508965 GACTCACAGCCCTGCCTGCATGG - Exonic
1185818920 X:3183003-3183025 GACTCACAGTCAATTCTGCATGG - Intergenic
1186452121 X:9682758-9682780 GGCTGACAGTCCTGCCTCCTGGG + Intronic
1186799773 X:13080973-13080995 CACTGGCTGTCCTGTCTGCCTGG + Intergenic
1194510097 X:94783290-94783312 GACTGACCTTTCTGGCTGCATGG + Intergenic
1197462979 X:126766035-126766057 GACAGAAAGTTCTGTCTTCATGG - Intergenic
1198239188 X:134766445-134766467 GCCTGCCAGTCCTGGCTGCCTGG - Intergenic
1198941519 X:141962540-141962562 GATTGGCAGCACTGTCTGCACGG - Intergenic
1200701059 Y:6402928-6402950 CACTCACAGACCTGTGTGCATGG - Intergenic
1200703378 Y:6421063-6421085 CACTGTCAGTCCTGTCCACAGGG - Intergenic
1200703900 Y:6425224-6425246 CACTGTCAGTCCTGTCCTCATGG - Intergenic
1200708096 Y:6459913-6459935 CACTTTCAGTCCTGTCCGCAGGG - Intergenic
1200911506 Y:8535353-8535375 CACTAGCAGTCCTGTCTTCAGGG + Intergenic
1200915518 Y:8567943-8567965 CACTAGCAGTCCTGCCTGCAGGG + Intergenic
1200916377 Y:8574790-8574812 CTCTAGCAGTCCTGTCTGCAGGG + Intergenic
1200919024 Y:8596617-8596639 TAGTAGCAGTCCTGTCTGCAGGG + Intergenic
1200919213 Y:8598297-8598319 CACTGGCTGTCCTGTCCGCAGGG + Intergenic
1200919727 Y:8602622-8602644 AACTAGCAGTCCTGACTGCAGGG + Intergenic
1200921696 Y:8618996-8619018 CACTAGCAGTCCTGTCTGCAGGG + Intergenic
1200923806 Y:8636495-8636517 CACTACCAGTCCTGTCTGCAAGG + Intergenic
1200924079 Y:8638910-8638932 CACTAGCAGTCCTGTCTGAAGGG + Intergenic
1200927773 Y:8669930-8669952 CATTAGCAGTCCTGTCTGCAGGG + Intergenic
1200930238 Y:8690374-8690396 AACTAGCAGTCTTGTCTGCAGGG - Intergenic
1200930718 Y:8694566-8694588 CACTAGTAGTCCTGTCTGCAGGG - Intergenic
1200935944 Y:8738478-8738500 CACTAGCAGTCCTGTCTGCAGGG - Intergenic
1200937931 Y:8754589-8754611 CACTAGCAGTCCTGTCTGCAGGG - Intergenic
1200939045 Y:8763548-8763570 CACTAACAGTCCTGTCTACAGGG - Intergenic
1200972197 Y:9164568-9164590 GAGTGACAGTACAGTTTGCAGGG - Intergenic
1200980302 Y:9257978-9258000 TACTAGCATTCCTGTCTGCAGGG + Intergenic
1200984530 Y:9291443-9291465 CACTAGCAGTCCTGTCTGCAGGG - Intergenic
1201026016 Y:9704795-9704817 CACTTTCAGTCCTGTCCGCAGGG + Intergenic
1201030211 Y:9739483-9739505 CACTGTCAGTCCTGTCCTCATGG + Intergenic
1201030732 Y:9743644-9743666 CACTGTCAGTCCTGTCCACAGGG + Intergenic
1201033053 Y:9761770-9761792 CACTCACAGACCTGTGTGCATGG + Intergenic
1202177757 Y:22113411-22113433 CACTAGCAGTCCTGTCTGCAGGG - Intergenic
1202213604 Y:22472984-22473006 CACTAGCAGTCCTGTCTGCAGGG + Intergenic