ID: 1036168461

View in Genome Browser
Species Human (GRCh38)
Location 8:6459785-6459807
Sequence CGACTGACAGTCCTGTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036168461_1036168464 30 Left 1036168461 8:6459785-6459807 CCTGCAGACAGGACTGTCAGTCG 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1036168464 8:6459838-6459860 ATGTGAAGGTGCCAGGTAGAAGG No data
1036168461_1036168462 16 Left 1036168461 8:6459785-6459807 CCTGCAGACAGGACTGTCAGTCG 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1036168462 8:6459824-6459846 GTGAGTTCTGAGTAATGTGAAGG No data
1036168461_1036168463 23 Left 1036168461 8:6459785-6459807 CCTGCAGACAGGACTGTCAGTCG 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1036168463 8:6459831-6459853 CTGAGTAATGTGAAGGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036168461 Original CRISPR CGACTGACAGTCCTGTCTGC AGG (reversed) Intronic
905104923 1:35558503-35558525 CGACTGAGAGCCCTGGCTGGAGG + Intronic
906078442 1:43068544-43068566 CGGCTGACAGCCCTGCCGGCTGG + Intergenic
912582773 1:110735327-110735349 AGACTGACAGTGCTGGGTGCCGG + Intergenic
913326784 1:117634785-117634807 AGACTGCCAGTCCTGTGAGCTGG + Intergenic
921890281 1:220346731-220346753 CATCTGACAGTCCTTTCTGCTGG + Intergenic
922700902 1:227760056-227760078 CAACTGACAGTTCTGTGGGCTGG - Intronic
1072303562 10:94085519-94085541 CTCCTAACAGTCCTGTCTGCAGG - Intronic
1077752706 11:4990334-4990356 AGAATGACAGTCCTATCTGGTGG - Intronic
1078889312 11:15539807-15539829 CGACTGACAGCCCAGGCTGATGG - Intergenic
1083871839 11:65493167-65493189 GAAGTGACAGGCCTGTCTGCTGG + Intergenic
1085709665 11:78817703-78817725 GGAGAGACAGTCCTGCCTGCAGG + Intronic
1090172516 11:124617203-124617225 CGAGTGACAGTGCTGACTGAGGG - Intronic
1093913594 12:24774996-24775018 CAACTAACAGGCCTGTCTGCTGG + Intergenic
1094554604 12:31485895-31485917 CCACTCACAGGCCTGTCTCCTGG - Intronic
1096785202 12:54013310-54013332 CAACTGGCTGGCCTGTCTGCAGG + Intronic
1097687790 12:62707312-62707334 CCACTGCCAGTCCAGTCTACTGG + Intronic
1103826644 12:123744466-123744488 CGGCTGACAGGGATGTCTGCGGG + Intronic
1112365356 13:98751766-98751788 CGACCGACATTCCTGTCTACAGG + Intronic
1117431148 14:55662981-55663003 AGACTGACACTGCTATCTGCTGG - Intronic
1121786555 14:96665854-96665876 CATCTGACAGTGCTGGCTGCTGG - Intergenic
1121931880 14:97979678-97979700 AGCCTGACTGTCCTGTTTGCAGG - Intergenic
1122539570 14:102490399-102490421 TGCCTGGCAGTCCTGCCTGCTGG - Intronic
1128222492 15:65979165-65979187 AGGCAGCCAGTCCTGTCTGCAGG - Intronic
1128849908 15:70943901-70943923 CGCCTGACATTCCTGGTTGCTGG + Intronic
1129897743 15:79121207-79121229 CGACAGGAAGCCCTGTCTGCTGG - Intergenic
1132473131 16:117983-118005 TGACTGCCACTCCTGTCTACAGG + Intronic
1139660557 16:68417855-68417877 TGTCAGACAGACCTGTCTGCCGG + Intronic
1142083222 16:88161357-88161379 GAACTGACAGTACTGCCTGCAGG + Intergenic
1142248668 16:88981132-88981154 CGACTTACATTCCTCTCTCCAGG - Intergenic
1142811058 17:2395704-2395726 GGGCTGACAGTCCGGGCTGCGGG + Intronic
1144208021 17:12992981-12993003 CCACTGAAAGCCCTGTTTGCTGG - Exonic
1144687573 17:17236526-17236548 CGACTGACAGTACTCTCAACTGG + Intronic
1147538304 17:41335087-41335109 TGACTGACAGTGCTGCCTCCTGG - Intergenic
1148341142 17:46874182-46874204 CCACCGACACTCCTCTCTGCTGG - Intronic
1152514643 17:80816255-80816277 CGCCTGGCAGGCCTGGCTGCAGG + Intronic
1157534218 18:48446761-48446783 AGACTGCCAGCCCTGTCTGTGGG + Intergenic
1160455865 18:78999527-78999549 AGACTGACCCTCCTGTGTGCAGG + Exonic
1160788132 19:911501-911523 CAACGGACACTCCTGTTTGCTGG + Intronic
1166750930 19:45163719-45163741 CGCCAGACAGTTCTCTCTGCAGG + Intronic
1167402097 19:49279741-49279763 AGACCGACTGTCCTGCCTGCAGG + Intergenic
925028863 2:633929-633951 CGACTGACAGCACTGTCTGTGGG - Intergenic
925880822 2:8350886-8350908 AGAGAGACAGTCCAGTCTGCTGG + Intergenic
927683452 2:25155070-25155092 CCTCCCACAGTCCTGTCTGCTGG + Exonic
928715683 2:34056930-34056952 CCACTGACAGTCCTCCCTGAGGG - Intergenic
932085091 2:68750737-68750759 TCACAGACAGTCCGGTCTGCAGG - Intronic
936031936 2:109079628-109079650 CAATTGACAGTCCCCTCTGCTGG - Intergenic
939629174 2:144513934-144513956 CGACACACATTCTTGTCTGCGGG + Intronic
943499880 2:188674470-188674492 CGCCTGACATTCCTGCTTGCAGG - Intergenic
948400620 2:237682320-237682342 CTCCGGGCAGTCCTGTCTGCTGG + Intronic
1170466787 20:16629568-16629590 TGACTGACAGTCCTGTGGGTTGG + Intergenic
1170505673 20:17023521-17023543 AGAGAGACAGTCCTGTCTTCTGG + Intergenic
1172567410 20:35941311-35941333 CAACTGGCAGTCCTGCTTGCAGG + Intronic
1173253064 20:41374796-41374818 AGACTGGCAGTCCTGGATGCGGG + Intergenic
1176793113 21:13343964-13343986 AAACTGACAGTGCTGTATGCTGG - Intergenic
1181086249 22:20440766-20440788 CAAGTTACAGCCCTGTCTGCGGG + Intronic
1181584508 22:23845722-23845744 CCCCTGCCAGTCCTCTCTGCCGG + Intergenic
1183568593 22:38634823-38634845 AGAATGACAGTGCTGTTTGCTGG - Intronic
1184641682 22:45876357-45876379 CGAGGGACAGGCCTGTCTTCTGG - Intergenic
1184767865 22:46581104-46581126 CTAATGACAGTCCCGTCTACAGG + Intronic
1185415057 22:50705271-50705293 AGACTGCCAGTCCTGTCCCCTGG + Intergenic
949871924 3:8596421-8596443 CCTCTGACAGCCCTGACTGCTGG - Intergenic
949929876 3:9070304-9070326 CCAGGGACAGCCCTGTCTGCAGG - Intronic
957685615 3:83501338-83501360 CAATGTACAGTCCTGTCTGCTGG + Intergenic
958913955 3:100026819-100026841 TGACTTACAGTTCTGGCTGCAGG - Intronic
969082070 4:4626699-4626721 ACACTGAAAGTCCTGTGTGCTGG + Intergenic
976890400 4:90039691-90039713 CCACTGGGAGTCCTGACTGCAGG - Intergenic
986826774 5:11531026-11531048 CTAATGACAGTTATGTCTGCAGG - Intronic
994301754 5:98156019-98156041 GGGCTGACAGTCCAGACTGCAGG + Intergenic
996998267 5:129725678-129725700 CGCCTGACATTCCTGGTTGCGGG + Intronic
1001664139 5:173418691-173418713 TGACTGTCCGTCATGTCTGCAGG + Intergenic
1002451786 5:179322984-179323006 CTCCCGCCAGTCCTGTCTGCAGG - Intronic
1004408030 6:15352748-15352770 AGACTTACAGTCATGTCTGAGGG - Intronic
1008667031 6:53726495-53726517 CGACTGACAACCCTTACTGCTGG - Intergenic
1009450724 6:63797370-63797392 CGAGTGAAAGTCCTTACTGCCGG + Intronic
1009847483 6:69151629-69151651 CCACTGATTGTCCTGTCTGCAGG - Intronic
1016206286 6:141472167-141472189 GGAGTGACCATCCTGTCTGCTGG - Intergenic
1016993310 6:149944078-149944100 GGACTCACTGTCCTGGCTGCAGG + Intronic
1017005023 6:150023452-150023474 GGACTCACTGTCCTGGCTGCAGG - Intronic
1019657641 7:2204926-2204948 AGACTGACCATCCTGACTGCTGG - Intronic
1023582794 7:41700254-41700276 CGACTGTCCGTCCTGTGCGCTGG - Exonic
1024551823 7:50568398-50568420 CCCCTGACACTCCTGTCTGTGGG - Intergenic
1034456566 7:151174096-151174118 GGACGGACCGTCCTGGCTGCGGG - Intronic
1035108649 7:156462473-156462495 CGACGGTGAGTGCTGTCTGCTGG + Intergenic
1035889726 8:3330122-3330144 TGAATGACATTTCTGTCTGCAGG - Intronic
1036168461 8:6459785-6459807 CGACTGACAGTCCTGTCTGCAGG - Intronic
1042668327 8:71232277-71232299 GGACTGACAGTGCAGGCTGCTGG - Intronic
1044066119 8:87702607-87702629 CCACTGATTGTCCTCTCTGCAGG + Intergenic
1049053157 8:140215037-140215059 TGGCTGACAGTGCTGTCTGTGGG - Intronic
1049919926 9:353649-353671 CATCTGACAGTTCTGTCTGGTGG + Intronic
1052122699 9:24738182-24738204 CCACTGAAAGGCCTGTCTCCAGG + Intergenic
1053621515 9:39824208-39824230 AAACTGACAGTGCTGTATGCTGG + Intergenic
1053883582 9:42620096-42620118 AAACTGACAGTGCTGTATGCTGG - Intergenic
1053889087 9:42674202-42674224 AAACTGACAGTGCTGTATGCTGG + Intergenic
1054222602 9:62427560-62427582 AAACTGACAGTGCTGTATGCTGG - Intergenic
1054228108 9:62481615-62481637 AAACTGACAGTGCTGTATGCTGG + Intergenic
1054262650 9:62883229-62883251 AAACTGACAGTGCTGTATGCTGG - Intergenic
1058937565 9:109783071-109783093 CGACTGGGATTCCAGTCTGCAGG + Intronic
1059395678 9:114032641-114032663 CGACTGAAAGCGCTTTCTGCTGG - Exonic
1186452120 X:9682757-9682779 AGGCTGACAGTCCTGCCTCCTGG + Intronic
1199845123 X:151687291-151687313 CTACTGATCGTCCTCTCTGCAGG + Intergenic
1200704990 Y:6435028-6435050 ACACTAGCAGTCCTGTCTGCAGG - Intergenic
1200919432 Y:8600134-8600156 AAACTAGCAGTCCTGTCTGCAGG + Intergenic
1200921695 Y:8618995-8619017 ACACTAGCAGTCCTGTCTGCAGG + Intergenic
1200935945 Y:8738479-8738501 ACACTAGCAGTCCTGTCTGCAGG - Intergenic
1200937932 Y:8754590-8754612 ACACTAGCAGTCCTGTCTGCAGG - Intergenic
1200939046 Y:8763549-8763571 ACACTAACAGTCCTGTCTACAGG - Intergenic
1200981238 Y:9264934-9264956 ACACTAGCAGTCCTGTCTGCAGG - Intergenic
1200984531 Y:9291444-9291466 ACACTAGCAGTCCTGTCTGCAGG - Intergenic
1201029121 Y:9729680-9729702 ACACTAGCAGTCCTGTCTGCAGG + Intergenic
1202177350 Y:22110016-22110038 GAACTAGCAGTCCTGTCTGCAGG - Intergenic
1202177758 Y:22113412-22113434 ACACTAGCAGTCCTGTCTGCAGG - Intergenic
1202213603 Y:22472983-22473005 ACACTAGCAGTCCTGTCTGCAGG + Intergenic
1202214011 Y:22476368-22476390 GAACTAGCAGTCCTGTCTGCAGG + Intergenic