ID: 1036168463

View in Genome Browser
Species Human (GRCh38)
Location 8:6459831-6459853
Sequence CTGAGTAATGTGAAGGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036168461_1036168463 23 Left 1036168461 8:6459785-6459807 CCTGCAGACAGGACTGTCAGTCG 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1036168463 8:6459831-6459853 CTGAGTAATGTGAAGGTGCCAGG No data
1036168460_1036168463 24 Left 1036168460 8:6459784-6459806 CCCTGCAGACAGGACTGTCAGTC 0: 1
1: 0
2: 0
3: 23
4: 183
Right 1036168463 8:6459831-6459853 CTGAGTAATGTGAAGGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036168463 Original CRISPR CTGAGTAATGTGAAGGTGCC AGG Intronic
No off target data available for this crispr