ID: 1036169425

View in Genome Browser
Species Human (GRCh38)
Location 8:6468369-6468391
Sequence AGCCTGCGGTCTGGGTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 224}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036169425_1036169432 12 Left 1036169425 8:6468369-6468391 CCCACACACCCAGACCGCAGGCT 0: 1
1: 0
2: 3
3: 23
4: 224
Right 1036169432 8:6468404-6468426 CCCTGGCCAGCCCCTCTTCTTGG No data
1036169425_1036169439 24 Left 1036169425 8:6468369-6468391 CCCACACACCCAGACCGCAGGCT 0: 1
1: 0
2: 3
3: 23
4: 224
Right 1036169439 8:6468416-6468438 CCTCTTCTTGGAGAGGAGAAAGG No data
1036169425_1036169430 -5 Left 1036169425 8:6468369-6468391 CCCACACACCCAGACCGCAGGCT 0: 1
1: 0
2: 3
3: 23
4: 224
Right 1036169430 8:6468387-6468409 AGGCTTATTCTTACTCTCCCTGG No data
1036169425_1036169434 17 Left 1036169425 8:6468369-6468391 CCCACACACCCAGACCGCAGGCT 0: 1
1: 0
2: 3
3: 23
4: 224
Right 1036169434 8:6468409-6468431 GCCAGCCCCTCTTCTTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036169425 Original CRISPR AGCCTGCGGTCTGGGTGTGT GGG (reversed) Intronic
900638568 1:3677274-3677296 AGGCTGAGGTCTGGGTTTGCCGG + Intronic
902410898 1:16210976-16210998 ACCCTGCTGTCTGGGAGGGTGGG + Intronic
903639429 1:24848389-24848411 TGCCAGCGGTCTGGGTGTGACGG + Intergenic
903797974 1:25944551-25944573 AGGCTGCTGGCTGGGTGTGGTGG + Intergenic
904391379 1:30188512-30188534 AGACTGCGGTGTTGGTGTCTGGG - Intergenic
905939514 1:41852174-41852196 AGCCTGGGGTCTGAGAGTGCTGG - Intronic
905944157 1:41887993-41888015 AGCCTGGGGTGGGGGTGTGATGG - Intronic
910104444 1:83616372-83616394 AGCCTGGGGTGTGGGTGTCAGGG - Intergenic
910195173 1:84632996-84633018 ATCCTGGTGTTTGGGTGTGTGGG - Intronic
913171347 1:116235007-116235029 AGACTGAGGGCTGGGTGTGATGG + Intergenic
915111354 1:153566334-153566356 AGCTTGAGGGCTGGGTGGGTGGG + Intronic
916018353 1:160770653-160770675 AGCCTGCCGTCTGAATGTGAAGG - Intergenic
917969952 1:180199965-180199987 AGCCTGTCCTCTGGGTGTGGGGG + Exonic
918696015 1:187547488-187547510 AGCCTCCAGGCTGGGTGTGTTGG + Intergenic
919452409 1:197787747-197787769 AGCCTGGAGTCTGGGTGTTTGGG + Intergenic
922472156 1:225883093-225883115 AGCTTGCGGTCCGGTTGTGGAGG - Intergenic
922870649 1:228899550-228899572 AGACTGCTGTCTGGGTGGGGAGG + Intergenic
923483862 1:234410651-234410673 AGCCCGGGGTCTGGGTGGGAAGG + Intronic
1062832761 10:617098-617120 TGCATGGGGTCTGGGTGTGGGGG - Intronic
1062980415 10:1717863-1717885 AGACTGGTGTCTGGGTGTGGGGG - Intronic
1064984652 10:21198037-21198059 ACCCTGCTGTCTCGGTGTGTTGG + Intergenic
1065746239 10:28845180-28845202 AGCCTGCTGTCTTGGTGTATTGG - Intergenic
1066648852 10:37637032-37637054 AGCCTGCTGTCTTGGTGCATTGG - Intergenic
1067031747 10:42882735-42882757 AGCCTGCTGTCTTGGTGCATTGG - Intergenic
1067567570 10:47349831-47349853 CGCCTCCGTCCTGGGTGTGTTGG + Exonic
1071603650 10:86970879-86970901 AGCCTCCGGTCTGGGAGCTTCGG - Exonic
1073086648 10:100895272-100895294 ACCCTGTGGTCTGGGTGCGGTGG - Intergenic
1075923878 10:126235293-126235315 AACCTCAGGCCTGGGTGTGTCGG + Intronic
1076114678 10:127886969-127886991 GGCCTGCCTTCTGGGTGGGTGGG + Intronic
1076191655 10:128487520-128487542 ACCCGGGGGTCTGGGTGTGGTGG + Intergenic
1076634317 10:131872668-131872690 AGCCTGGGGTCTGGCTGAGTAGG - Intergenic
1077184433 11:1229928-1229950 CGCCTGCGGTGGGGGTGTGGAGG + Intronic
1077422922 11:2461395-2461417 AGCCTGCTGACTGGGTGAGCCGG + Intronic
1078737372 11:14032918-14032940 AGCTTCTGGTCTGGGTATGTGGG - Intronic
1079870639 11:25794198-25794220 AGCCCAAGGTCTGGGTGTTTAGG - Intergenic
1080484851 11:32695079-32695101 AGCTTGCTGTCCGGGTGTGGTGG + Intronic
1081810558 11:45911734-45911756 AGCCTGGGGGCCGGGTGTGGTGG + Intronic
1083335324 11:61918441-61918463 AGCCTGCGGCCTGAGTCAGTGGG - Intronic
1083826386 11:65206379-65206401 AGCCTGGAGTCTGGGTCTGGGGG + Intronic
1084172394 11:67406775-67406797 AGCCTGGGCTCTGGGGGTGGCGG + Intronic
1087272728 11:96128051-96128073 AGGATGCGGACTGGGTGTCTGGG + Intronic
1088420029 11:109635690-109635712 AGCCTAGAGGCTGGGTGTGTAGG + Intergenic
1089536029 11:119161266-119161288 AGCCTGGGCTCTGGGAGTGGGGG + Exonic
1090317215 11:125803622-125803644 AGCCTGGAGTCTGGGTCTGCAGG + Intergenic
1090350677 11:126105869-126105891 TGCCTGGGGCCTGGGAGTGTGGG - Intergenic
1092752095 12:11728303-11728325 AGTCTGCGGTCTGGGGGTTGGGG - Intronic
1095700768 12:45188733-45188755 AGGCTGCAGGCTGGGTGTGGTGG + Intergenic
1095963585 12:47851475-47851497 AGACTTCTGTGTGGGTGTGTGGG - Intronic
1097173486 12:57129649-57129671 AGCCTGGGGTAGGGCTGTGTTGG + Intronic
1099948303 12:89270962-89270984 AGGCTGGGGGCGGGGTGTGTGGG + Intergenic
1102166985 12:110814656-110814678 AGGCTGTGATCTGGCTGTGTTGG + Intergenic
1102639636 12:114355676-114355698 AGCCTGTGGTCAGGCAGTGTGGG - Exonic
1102937380 12:116909223-116909245 AGCCTGAGCCCTGGGTTTGTAGG + Intergenic
1106032631 13:26016807-26016829 ATCCTGCAGCCTGGGTGTGACGG + Intronic
1106578703 13:30999602-30999624 AGCCTGGGGTTTGTGTGAGTTGG + Intergenic
1107725966 13:43299567-43299589 AGCCTGCAGCCTGGGTGTGAAGG - Intronic
1116432795 14:44866479-44866501 AGCCTGGAGCCTGGGTCTGTAGG + Intergenic
1117202961 14:53411334-53411356 AGGCAGTGTTCTGGGTGTGTGGG - Intergenic
1118520297 14:66575809-66575831 GGCCTGGTGTCTGGGTGTCTGGG + Intronic
1119273168 14:73327910-73327932 AGGCTGGGGACTGGGTGTGGTGG - Intronic
1119325182 14:73755580-73755602 AGCCTGGGGCCTGGGCGGGTAGG + Intronic
1120189469 14:81427400-81427422 AGACTCCGGTCTGGGTGACTTGG - Exonic
1121901221 14:97694964-97694986 AGCCTGTACTCGGGGTGTGTGGG + Intergenic
1123060446 14:105592001-105592023 GGCCTGTGGTCTGGCTGTGGTGG + Intergenic
1123084924 14:105712972-105712994 GGCCTGTGGTCTGGCTGTGGTGG + Intergenic
1125693445 15:41615636-41615658 GGCCTGTGGGCTGGGTGTGGTGG + Intergenic
1125711746 15:41792508-41792530 AGGCTGCATTCTGGGTGTGGAGG + Intronic
1127974356 15:63986165-63986187 AGCCTGGGGGCTGGGTCTGGTGG - Intronic
1127974626 15:63987979-63988001 AGCATGAGGTGTGGGTGGGTGGG + Intronic
1128614600 15:69099386-69099408 ACCGTGAGGTCTGGGTATGTTGG + Intergenic
1132810038 16:1793045-1793067 AGCCTGCTGGCTGGGTCTGTGGG - Intronic
1132932166 16:2464337-2464359 AGCCTGGGGTCTGTGTGTGTGGG + Intronic
1133322773 16:4924679-4924701 AGCCTGGTGCCTGGGTGTGGAGG + Intronic
1134683399 16:16142070-16142092 AGCCTGGAGTCGGGGTGGGTGGG - Exonic
1135432370 16:22396492-22396514 AGCCTGAGGGCTGGGTGCGGTGG - Intronic
1137084246 16:36101416-36101438 AGCCTGGGGTGCGGGTGTCTAGG + Intergenic
1138245182 16:55462208-55462230 AGCCTGCGGTGGGAGTTTGTAGG + Intronic
1141700377 16:85639506-85639528 AGCCTGCCTTGCGGGTGTGTCGG + Intronic
1141841399 16:86576487-86576509 ATCTCTCGGTCTGGGTGTGTTGG + Intronic
1142333062 16:89468089-89468111 AGACTGCAGTCTGGGCGTGGTGG - Intronic
1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG + Exonic
1142962198 17:3557917-3557939 AGGCTGCTGTGTGGGTGTGGGGG - Intronic
1145057475 17:19712935-19712957 ATCCTGAGGCCTGGGTGTTTGGG - Intronic
1145222097 17:21097757-21097779 AGCCTGGGGTAAGGGTGTTTTGG + Intergenic
1148427346 17:47610667-47610689 AGCCGGGGGTCTGGGTGTGGTGG - Intronic
1148906363 17:50914978-50915000 AGCCTGCGGTCTCTGGGTGGAGG + Intergenic
1149549155 17:57527268-57527290 TGCCTGGGGTGTGGGTGGGTGGG - Intronic
1150072823 17:62167122-62167144 GGACTGCAGTATGGGTGTGTGGG - Intergenic
1151452552 17:74207289-74207311 AAACTCCGGTCTGGGTGTGGTGG - Intronic
1152863656 17:82709854-82709876 AGCCTGCGGTGTGGATGCCTGGG - Intergenic
1154202859 18:12310999-12311021 AGCGTGCGGTCTGGGCCTTTTGG + Exonic
1160388475 18:78512459-78512481 AGCATGCAGTCTGGGGGCGTGGG + Intergenic
1160840278 19:1143661-1143683 AGCCTGCGCTCTGGCCGTGAAGG - Intronic
1161107419 19:2451531-2451553 AGCCTGCGGAACGGGTGTGCCGG + Intronic
1161534893 19:4812844-4812866 AGCCTTCGGGCTGGGTGCGGTGG - Intergenic
1162049882 19:8026700-8026722 AGCCTGCGTGCTGGGCGTTTAGG - Intronic
1162133771 19:8543341-8543363 AGCCTTCGGTAGGGGTCTGTAGG + Intronic
1162528751 19:11223130-11223152 GGGCTGAGGTTTGGGTGTGTGGG - Intronic
1163396880 19:17069137-17069159 GGCGTGGGGTCTGGGTGTGTGGG - Intronic
1163648480 19:18503584-18503606 ACCCTGAGCTCTGGGTGTCTGGG - Intronic
1164449802 19:28350785-28350807 AGCCTGGTGTCTGGGACTGTTGG - Intergenic
1164632434 19:29770320-29770342 AGTCTGGGGTCAGTGTGTGTGGG - Intergenic
1164694600 19:30233934-30233956 AGCCTGGTGTCAGGGTGTGGTGG - Intronic
1165145577 19:33727950-33727972 AGCCTGCTCTTTGGGAGTGTGGG - Intronic
1168574404 19:57498105-57498127 AGCCTGCGGTCTGAGGGGGAAGG + Intronic
1202669838 1_KI270709v1_random:40347-40369 AGCCTGGGGCGTGGGTGTCTAGG - Intergenic
926198265 2:10776470-10776492 TGCCTGGTGTCTGGGTCTGTGGG - Intronic
927189831 2:20509997-20510019 AGCCTTCTGCCTGGATGTGTTGG - Intergenic
928171813 2:29009276-29009298 AGCCTGCGGGGTGGGGGTGAAGG + Intronic
932411173 2:71548887-71548909 TGCCTGCGGGCTTGGAGTGTGGG + Intronic
932576000 2:72962802-72962824 ACCTTGCGGTCTGGGCCTGTGGG - Intronic
932878123 2:75474343-75474365 AGGCTGAGGTTTGGGGGTGTTGG + Intronic
934925623 2:98380107-98380129 AGACTGGGGTTTGGGGGTGTGGG + Intronic
935029872 2:99311580-99311602 AGCCTGAGGGCTGGGTGTGGTGG - Intronic
936404121 2:112187294-112187316 AGCCTGCGGTTTGGGATCGTGGG + Exonic
936521568 2:113215125-113215147 AGCCTGGGGGCTGGCTTTGTAGG + Intergenic
937023516 2:118679436-118679458 ATACTGCTGTCTTGGTGTGTGGG - Intergenic
937774741 2:125763000-125763022 AGTCTGAGGGCTGGGTGTGGTGG + Intergenic
939760498 2:146171483-146171505 ACCCTGCTGTCTTGGTGTATTGG - Intergenic
941221485 2:162787244-162787266 AGCTTGAGTTCTGGGTCTGTGGG - Intronic
942541756 2:177022324-177022346 AGCCGGGGGTCTGGGCGGGTGGG - Intergenic
943548225 2:189308107-189308129 AAACTGGGGTGTGGGTGTGTAGG + Intergenic
946096800 2:217281497-217281519 AGACTGCTGGCTGGGTGTGGTGG - Intergenic
946225470 2:218261958-218261980 AGCCTCAGGCCTGGGGGTGTGGG + Intronic
946238560 2:218340353-218340375 AGCCAGAGGGCTGGGGGTGTTGG + Intronic
946662778 2:222019114-222019136 AGCCTGGGGTCTGAATGAGTTGG + Intergenic
947815767 2:233035092-233035114 AGCCTCCGAGCTGGGTGTGCAGG - Intergenic
948519610 2:238527512-238527534 AGCCTGGGTCCTGGGTGTCTCGG - Intergenic
1170329300 20:15190901-15190923 AGTATGCGGTCTGGATGGGTTGG + Intronic
1171165374 20:22965741-22965763 AGCCTTGGGTCTGGGAGTGATGG + Intergenic
1172480239 20:35267243-35267265 ATCCTGCGGACGGGGAGTGTAGG - Exonic
1172656937 20:36543201-36543223 ACACTGAGGGCTGGGTGTGTCGG + Intronic
1173708709 20:45135849-45135871 ACCTTGGGGGCTGGGTGTGTGGG + Intergenic
1175008880 20:55714458-55714480 AGCCTGTGGTCTTGGTGCCTAGG - Intergenic
1175144366 20:56884646-56884668 AGGCTGCAGGCTGGGTGTGATGG - Intergenic
1175884282 20:62280070-62280092 AGCATCCGGTCTGTGTCTGTCGG - Intronic
1176174456 20:63712606-63712628 AGCCTTCTGGCTGGGTGTGGTGG + Intronic
1178316369 21:31569876-31569898 AGCATGCAGTCTGGGTGTCGCGG + Intergenic
1178937966 21:36880907-36880929 CTCCTGCGTTCTGGGTGTTTGGG + Intronic
1180916471 22:19492091-19492113 AACCTGCTGGCTGGGTGTGGTGG - Intronic
1180995744 22:19964427-19964449 CACCTGAGGTCTGGGAGTGTGGG + Intronic
1181887231 22:26031031-26031053 CGCATGCGTTCAGGGTGTGTGGG - Exonic
1183457530 22:37930737-37930759 AGCCTGGGCTCTGGGTGTGTGGG + Intronic
1183791785 22:40077180-40077202 AGCCTGAGTTCAGGGTTTGTAGG - Intronic
1184607371 22:45581854-45581876 AGCCTGCGGTTTGGGGCTGCTGG + Intronic
1185194264 22:49458933-49458955 AGCCTGGGGTCAGGGAGTGTAGG - Intronic
949987383 3:9552057-9552079 AGCCTTGGGACTGGGTGGGTGGG - Intronic
950093672 3:10315461-10315483 AGCCTGCAGGCTGGGTGGGTGGG + Intronic
950147872 3:10664638-10664660 AGCCTGGGATCTGGGTCTGTTGG + Intronic
954083208 3:48224465-48224487 AGGCTGGGGGCTGGGGGTGTTGG + Intronic
956454268 3:69405459-69405481 ATCCTGTGGTCTGGGAGGGTGGG + Intronic
960733003 3:120746506-120746528 ATCCTGTGGGCTGGGTGTGGTGG + Intronic
961561342 3:127732564-127732586 GCCCTGGGGTCTGGGCGTGTAGG - Intronic
961821387 3:129577403-129577425 AGCCAGGGGGCTGGGTGGGTGGG - Intronic
965837898 3:172871236-172871258 AGCCTGGGGGCTGGGCGTGGGGG + Intergenic
968128677 3:196178930-196178952 TTCCTTCGGGCTGGGTGTGTTGG - Intergenic
968544511 4:1191915-1191937 GGCCTGAAGGCTGGGTGTGTAGG - Intronic
969094782 4:4724057-4724079 AGCCTGGAGTCAGTGTGTGTTGG + Intergenic
976266317 4:83188797-83188819 AGAGTGAGGTTTGGGTGTGTCGG + Intergenic
978575806 4:110188988-110189010 ACCCTGCTGTCTAGGTGTGGTGG + Intronic
980043774 4:127966569-127966591 AACGTGCGGTCTGGGTGCGATGG + Intronic
980625652 4:135371781-135371803 AGCCTGCAATCTGGGCTTGTAGG + Intergenic
981584343 4:146285069-146285091 AGACTGCAGTATGGGAGTGTAGG + Intronic
982160493 4:152564009-152564031 ATCTTGAGGGCTGGGTGTGTTGG - Intergenic
984769849 4:183427806-183427828 TGCCTGCAGGCTGGGTGTGGTGG - Intergenic
986180184 5:5385669-5385691 TGCCTGGGGTGTGGGTGAGTTGG - Intergenic
989489888 5:42037940-42037962 ACCCTGCAGTCTTGGTGTGTTGG + Intergenic
990800598 5:59598570-59598592 AGGCTGCTGCCTGTGTGTGTGGG + Intronic
991141461 5:63248962-63248984 AGCCTGCAGGCTGGAAGTGTTGG + Intergenic
991540869 5:67726721-67726743 AGCCAGAGGTCTGTGAGTGTTGG - Intergenic
991637080 5:68716830-68716852 AGGCTGCAGTCTGGGTTTGGAGG - Intergenic
992405546 5:76454185-76454207 GGCCTGCAGACTGGGTTTGTGGG - Intronic
992537219 5:77719411-77719433 TGGCTGGGGTCAGGGTGTGTAGG - Intronic
994002104 5:94792422-94792444 AGCCTGTGGACTGGGTGAATAGG + Intronic
995490369 5:112684717-112684739 AGTCTGAGGACTGTGTGTGTTGG + Intergenic
996040919 5:118810090-118810112 GGCCTGGAGCCTGGGTGTGTAGG - Intergenic
996191549 5:120549362-120549384 AGCCTGGGCCCTGGGTGTGGTGG - Intronic
996292228 5:121865960-121865982 TGCCAGTGGTCTGGGTGTCTGGG - Intergenic
996677018 5:126188055-126188077 AGCCTGCGCTCTGGGAGGTTGGG + Intergenic
997037696 5:130212988-130213010 AGCCTTCGGTCTGTGTCTGAAGG + Intergenic
997582874 5:135028314-135028336 GGCCTGCGGACTGGATGTGCGGG - Exonic
998165290 5:139839187-139839209 AACCTGCAGCATGGGTGTGTTGG - Intronic
999195710 5:149780187-149780209 AGCCTGTGCTCTGGGTGTGTGGG - Intronic
1000179325 5:158792576-158792598 AGCCTGCTTCCTGGGTGTGTTGG + Intronic
1000743189 5:164995997-164996019 AAACTGCTGTCTGTGTGTGTGGG + Intergenic
1001366296 5:171144073-171144095 AGGCTGCCGTCTGGGCGTGGTGG + Intronic
1002164087 5:177333891-177333913 AGCCAGGGGGCTGGGTATGTTGG - Intronic
1002301895 5:178262125-178262147 ACCCTGCTGTCGGCGTGTGTGGG + Intronic
1002475394 5:179462193-179462215 AGCCTGCAGTGTGGGCGTGGTGG - Intergenic
1002837008 6:873449-873471 AGCCTGAGATCGGGTTGTGTAGG - Intergenic
1003255344 6:4470468-4470490 AGCCTGGGTTCTGGGTTTATAGG - Intergenic
1006679596 6:35787522-35787544 AGCCTCTGAGCTGGGTGTGTAGG + Intronic
1006728267 6:36215686-36215708 GGCCTCAGGCCTGGGTGTGTGGG + Intronic
1006767444 6:36520605-36520627 AGTGTGTGGTATGGGTGTGTAGG - Intronic
1007575978 6:42925459-42925481 AGGCTGGGGTCTGGGTGAGCTGG - Exonic
1009742065 6:67758662-67758684 AGCCTGGAGCCTGGGTCTGTGGG - Intergenic
1012583904 6:100899378-100899400 AGCCTGCGCACTGGGGGGGTTGG + Intergenic
1016153911 6:140780431-140780453 AGCCAGGGGACTGGGTGAGTAGG + Intergenic
1016952577 6:149594483-149594505 AGCCTGTGGTCTTGGTGTGCTGG - Intergenic
1017330956 6:153197845-153197867 AGCTTTCGGGCTGGGTGTGGTGG - Intergenic
1018176905 6:161184962-161184984 CTCCTGTGCTCTGGGTGTGTGGG - Intronic
1018203168 6:161413584-161413606 AGCCTGGGAACTGGGGGTGTTGG + Intronic
1018345678 6:162896726-162896748 AGCAAGCGGTCTGTGTGTGAAGG + Intronic
1018968652 6:168509113-168509135 AGCCTCCGATCTGGGCGTGCTGG - Intronic
1019274742 7:170049-170071 AGCCACCGGGCTGGGTGTGCAGG - Intergenic
1020131308 7:5560081-5560103 AGTCTGTGGGCTGGGTGTGGTGG + Intronic
1022943654 7:35261692-35261714 AGCCTTCGGGCTCGGGGTGTCGG - Intergenic
1024025129 7:45403572-45403594 ATCCTGCTGTCTCGGTGTATTGG + Intergenic
1025320363 7:58088006-58088028 AGCCTGGGGTGCGGGTGTCTAGG - Intergenic
1026213857 7:68330828-68330850 ACCCTGCTGTCTTGGTGTGTTGG + Intergenic
1026915971 7:74120685-74120707 AGCCTGCAGCCTGGGTGAGTGGG - Intronic
1029237877 7:99137493-99137515 AGCCTGCGTTCTTTGTATGTTGG - Intronic
1030014639 7:105206441-105206463 ACCCTGCAGTCTAAGTGTGTAGG + Intronic
1032093389 7:128923298-128923320 AGCCTGGGGGCTGGGTGAGGAGG + Intergenic
1033587007 7:142781457-142781479 AGGTTGCTGTCTGGGTGTGGTGG - Intergenic
1034530534 7:151693609-151693631 AGGCTGTGGTCTGAATGTGTGGG + Intronic
1034913788 7:155020161-155020183 AGCATGCAGGCTGGGTGTGGTGG + Intergenic
1034968832 7:155407197-155407219 AGTGTGCGGTGTGGGAGTGTGGG + Intergenic
1034969208 7:155408745-155408767 AGTTTGAGGTGTGGGTGTGTCGG + Intergenic
1036169425 8:6468369-6468391 AGCCTGCGGTCTGGGTGTGTGGG - Intronic
1036435988 8:8733864-8733886 AGCCTGGAGGCTGGGTGTGATGG - Intergenic
1039124956 8:34191309-34191331 AGCCTTCTGGCTGGGTGTGGTGG + Intergenic
1039613415 8:38936890-38936912 GGCCTGCAGTGAGGGTGTGTGGG - Intronic
1043531982 8:81161200-81161222 AGCCTGTGTTCTGGGTGAGGAGG + Intergenic
1044410603 8:91878318-91878340 AGCCTGCTGTCCGGGAGTGAGGG - Intergenic
1044745295 8:95365128-95365150 AGCCTGCGGTCTGGTACTGAGGG - Intergenic
1046507160 8:115150813-115150835 AACCTCCAGTCTGGGTGTGGTGG - Intergenic
1047748721 8:127864386-127864408 GGCCTGCCGTCAGGGTTTGTGGG + Intergenic
1048110009 8:131457731-131457753 AGACTGAGGGCTGGGTGTGGTGG + Intergenic
1048986441 8:139737492-139737514 AGTCTGGTGTCTGGGTGTGTAGG + Intronic
1050565378 9:6876784-6876806 AACCTGCAGTCTATGTGTGTAGG - Intronic
1051546286 9:18279832-18279854 AGCCTGGAGCCTGGGTCTGTGGG + Intergenic
1051736892 9:20209565-20209587 AGCCCCCAGTCTGGGGGTGTTGG - Intergenic
1052662327 9:31449809-31449831 TGCCTGTGGTGTGTGTGTGTGGG - Intergenic
1053495166 9:38544213-38544235 GGCCTGAGGACAGGGTGTGTTGG - Intronic
1057757145 9:97847814-97847836 AGCCTGCGGGCTGGAAGTGAGGG - Intergenic
1057798329 9:98173827-98173849 AGCCTTTGGTCTGGGTGTGGTGG + Intronic
1057934164 9:99222463-99222485 AGCCTCGGGTGTGGGTGTCTAGG + Intronic
1060148139 9:121268969-121268991 AGGCTGGGGGCTGGGGGTGTGGG + Intronic
1060237833 9:121878613-121878635 AGCATGAGTTCTGGGTCTGTGGG - Intronic
1061452283 9:130674434-130674456 AGCCTACAGTTTGGGTGTGGTGG - Intronic
1062439443 9:136563179-136563201 AGCCCGCTGGCTGGGTGTGTGGG + Intergenic
1187070997 X:15888244-15888266 AGCCTGTGCTCTGGGTGTCCAGG - Intergenic
1187555710 X:20349292-20349314 AGCATTCGGGCTGGGTGTGGTGG + Intergenic
1190605500 X:52138820-52138842 AGCTTGAAGTCTGGGTCTGTGGG - Intergenic
1192382874 X:70636163-70636185 TGCCTGGGGCCTGGGTCTGTGGG - Intronic
1192737584 X:73863686-73863708 AGCCTGGAGGCTGGGTGTGTAGG - Intergenic
1196566408 X:117210264-117210286 AGCCTGGTGCCTGGGTCTGTGGG - Intergenic
1197654320 X:129099770-129099792 TGCATGGGATCTGGGTGTGTGGG + Intergenic
1198967758 X:142245050-142245072 GGCCTGGAGGCTGGGTGTGTGGG - Intergenic
1201392436 Y:13513012-13513034 AGTCTGGAGTCTGGGTCTGTGGG - Intergenic