ID: 1036178393

View in Genome Browser
Species Human (GRCh38)
Location 8:6561971-6561993
Sequence CACCGGTTGCTGGAACTGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036178388_1036178393 -3 Left 1036178388 8:6561951-6561973 CCACGTGGGGACGCATTCCGCAC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1036178393 8:6561971-6561993 CACCGGTTGCTGGAACTGACGGG No data
1036178386_1036178393 2 Left 1036178386 8:6561946-6561968 CCGTCCCACGTGGGGACGCATTC 0: 1
1: 0
2: 2
3: 3
4: 50
Right 1036178393 8:6561971-6561993 CACCGGTTGCTGGAACTGACGGG No data
1036178387_1036178393 -2 Left 1036178387 8:6561950-6561972 CCCACGTGGGGACGCATTCCGCA 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1036178393 8:6561971-6561993 CACCGGTTGCTGGAACTGACGGG No data
1036178382_1036178393 28 Left 1036178382 8:6561920-6561942 CCTGTCGTGGCATGACTTGAACA 0: 1
1: 0
2: 0
3: 5
4: 50
Right 1036178393 8:6561971-6561993 CACCGGTTGCTGGAACTGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036178393 Original CRISPR CACCGGTTGCTGGAACTGAC GGG Intronic
No off target data available for this crispr