ID: 1036183414

View in Genome Browser
Species Human (GRCh38)
Location 8:6604182-6604204
Sequence CCTTCCAGGTTTGCACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036183401_1036183414 29 Left 1036183401 8:6604130-6604152 CCCTGTCTCATCTAGCTCAGCCC 0: 1
1: 0
2: 0
3: 19
4: 191
Right 1036183414 8:6604182-6604204 CCTTCCAGGTTTGCACTGGAAGG No data
1036183402_1036183414 28 Left 1036183402 8:6604131-6604153 CCTGTCTCATCTAGCTCAGCCCC 0: 1
1: 0
2: 1
3: 15
4: 161
Right 1036183414 8:6604182-6604204 CCTTCCAGGTTTGCACTGGAAGG No data
1036183409_1036183414 -9 Left 1036183409 8:6604168-6604190 CCGCAGCCAAGTGGCCTTCCAGG 0: 1
1: 0
2: 1
3: 25
4: 275
Right 1036183414 8:6604182-6604204 CCTTCCAGGTTTGCACTGGAAGG No data
1036183405_1036183414 8 Left 1036183405 8:6604151-6604173 CCCCATGCTGTCATAGGCCGCAG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1036183414 8:6604182-6604204 CCTTCCAGGTTTGCACTGGAAGG No data
1036183404_1036183414 9 Left 1036183404 8:6604150-6604172 CCCCCATGCTGTCATAGGCCGCA 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1036183414 8:6604182-6604204 CCTTCCAGGTTTGCACTGGAAGG No data
1036183407_1036183414 6 Left 1036183407 8:6604153-6604175 CCATGCTGTCATAGGCCGCAGCC 0: 1
1: 0
2: 1
3: 11
4: 108
Right 1036183414 8:6604182-6604204 CCTTCCAGGTTTGCACTGGAAGG No data
1036183406_1036183414 7 Left 1036183406 8:6604152-6604174 CCCATGCTGTCATAGGCCGCAGC 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1036183414 8:6604182-6604204 CCTTCCAGGTTTGCACTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036183414 Original CRISPR CCTTCCAGGTTTGCACTGGA AGG Intronic
No off target data available for this crispr