ID: 1036186151

View in Genome Browser
Species Human (GRCh38)
Location 8:6624130-6624152
Sequence CCCGCCCGTGGGTTTTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036186145_1036186151 1 Left 1036186145 8:6624106-6624128 CCGGTTGTTTTGCCGCTCGGCTC 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1036186151 8:6624130-6624152 CCCGCCCGTGGGTTTTCAGGAGG No data
1036186143_1036186151 4 Left 1036186143 8:6624103-6624125 CCTCCGGTTGTTTTGCCGCTCGG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1036186151 8:6624130-6624152 CCCGCCCGTGGGTTTTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036186151 Original CRISPR CCCGCCCGTGGGTTTTCAGG AGG Intronic
No off target data available for this crispr