ID: 1036186879

View in Genome Browser
Species Human (GRCh38)
Location 8:6629875-6629897
Sequence TTGGTAAGAAGCAGGATCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036186870_1036186879 15 Left 1036186870 8:6629837-6629859 CCCAGTCCTGGCCCCTGATTTTC 0: 1
1: 0
2: 0
3: 24
4: 277
Right 1036186879 8:6629875-6629897 TTGGTAAGAAGCAGGATCTTAGG No data
1036186871_1036186879 14 Left 1036186871 8:6629838-6629860 CCAGTCCTGGCCCCTGATTTTCA 0: 1
1: 0
2: 2
3: 26
4: 364
Right 1036186879 8:6629875-6629897 TTGGTAAGAAGCAGGATCTTAGG No data
1036186873_1036186879 4 Left 1036186873 8:6629848-6629870 CCCCTGATTTTCAGTTTAGAATC 0: 1
1: 0
2: 1
3: 22
4: 273
Right 1036186879 8:6629875-6629897 TTGGTAAGAAGCAGGATCTTAGG No data
1036186869_1036186879 16 Left 1036186869 8:6629836-6629858 CCCCAGTCCTGGCCCCTGATTTT 0: 1
1: 0
2: 3
3: 26
4: 328
Right 1036186879 8:6629875-6629897 TTGGTAAGAAGCAGGATCTTAGG No data
1036186867_1036186879 23 Left 1036186867 8:6629829-6629851 CCCAGAACCCCAGTCCTGGCCCC 0: 1
1: 0
2: 4
3: 48
4: 442
Right 1036186879 8:6629875-6629897 TTGGTAAGAAGCAGGATCTTAGG No data
1036186874_1036186879 3 Left 1036186874 8:6629849-6629871 CCCTGATTTTCAGTTTAGAATCT 0: 1
1: 0
2: 2
3: 27
4: 360
Right 1036186879 8:6629875-6629897 TTGGTAAGAAGCAGGATCTTAGG No data
1036186872_1036186879 9 Left 1036186872 8:6629843-6629865 CCTGGCCCCTGATTTTCAGTTTA 0: 1
1: 0
2: 1
3: 39
4: 327
Right 1036186879 8:6629875-6629897 TTGGTAAGAAGCAGGATCTTAGG No data
1036186868_1036186879 22 Left 1036186868 8:6629830-6629852 CCAGAACCCCAGTCCTGGCCCCT 0: 1
1: 0
2: 7
3: 80
4: 632
Right 1036186879 8:6629875-6629897 TTGGTAAGAAGCAGGATCTTAGG No data
1036186875_1036186879 2 Left 1036186875 8:6629850-6629872 CCTGATTTTCAGTTTAGAATCTT 0: 1
1: 0
2: 5
3: 39
4: 363
Right 1036186879 8:6629875-6629897 TTGGTAAGAAGCAGGATCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036186879 Original CRISPR TTGGTAAGAAGCAGGATCTT AGG Intronic
No off target data available for this crispr