ID: 1036187325

View in Genome Browser
Species Human (GRCh38)
Location 8:6635276-6635298
Sequence CAGTGTTAACGTCATCTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036187325_1036187332 21 Left 1036187325 8:6635276-6635298 CCATGAAGATGACGTTAACACTG No data
Right 1036187332 8:6635320-6635342 GCGTGGAGCTCAGGTGTGATGGG No data
1036187325_1036187326 -5 Left 1036187325 8:6635276-6635298 CCATGAAGATGACGTTAACACTG No data
Right 1036187326 8:6635294-6635316 CACTGCAGAAAAAGCACCCGTGG No data
1036187325_1036187327 4 Left 1036187325 8:6635276-6635298 CCATGAAGATGACGTTAACACTG No data
Right 1036187327 8:6635303-6635325 AAAAGCACCCGTGGACAGCGTGG No data
1036187325_1036187330 12 Left 1036187325 8:6635276-6635298 CCATGAAGATGACGTTAACACTG No data
Right 1036187330 8:6635311-6635333 CCGTGGACAGCGTGGAGCTCAGG No data
1036187325_1036187331 20 Left 1036187325 8:6635276-6635298 CCATGAAGATGACGTTAACACTG No data
Right 1036187331 8:6635319-6635341 AGCGTGGAGCTCAGGTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036187325 Original CRISPR CAGTGTTAACGTCATCTTCA TGG (reversed) Intronic