ID: 1036187331

View in Genome Browser
Species Human (GRCh38)
Location 8:6635319-6635341
Sequence AGCGTGGAGCTCAGGTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036187324_1036187331 24 Left 1036187324 8:6635272-6635294 CCGACCATGAAGATGACGTTAAC No data
Right 1036187331 8:6635319-6635341 AGCGTGGAGCTCAGGTGTGATGG No data
1036187325_1036187331 20 Left 1036187325 8:6635276-6635298 CCATGAAGATGACGTTAACACTG No data
Right 1036187331 8:6635319-6635341 AGCGTGGAGCTCAGGTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036187331 Original CRISPR AGCGTGGAGCTCAGGTGTGA TGG Intronic