ID: 1036190237

View in Genome Browser
Species Human (GRCh38)
Location 8:6663371-6663393
Sequence CACCTTTAGCAACAAGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036190237_1036190238 -4 Left 1036190237 8:6663371-6663393 CCAAGTTCTTGTTGCTAAAGGTG No data
Right 1036190238 8:6663390-6663412 GGTGTTCAACAGAGAAATGTTGG No data
1036190237_1036190239 -1 Left 1036190237 8:6663371-6663393 CCAAGTTCTTGTTGCTAAAGGTG No data
Right 1036190239 8:6663393-6663415 GTTCAACAGAGAAATGTTGGAGG No data
1036190237_1036190241 11 Left 1036190237 8:6663371-6663393 CCAAGTTCTTGTTGCTAAAGGTG No data
Right 1036190241 8:6663405-6663427 AATGTTGGAGGGCCAATTAAAGG No data
1036190237_1036190240 0 Left 1036190237 8:6663371-6663393 CCAAGTTCTTGTTGCTAAAGGTG No data
Right 1036190240 8:6663394-6663416 TTCAACAGAGAAATGTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036190237 Original CRISPR CACCTTTAGCAACAAGAACT TGG (reversed) Intergenic
No off target data available for this crispr