ID: 1036191235

View in Genome Browser
Species Human (GRCh38)
Location 8:6671858-6671880
Sequence TGTTAGTCCTAGAATGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036191228_1036191235 8 Left 1036191228 8:6671827-6671849 CCAATGAGACCCAGAAAAGTAGC No data
Right 1036191235 8:6671858-6671880 TGTTAGTCCTAGAATGGCAGAGG No data
1036191227_1036191235 15 Left 1036191227 8:6671820-6671842 CCTTCTTCCAATGAGACCCAGAA No data
Right 1036191235 8:6671858-6671880 TGTTAGTCCTAGAATGGCAGAGG No data
1036191233_1036191235 -2 Left 1036191233 8:6671837-6671859 CCAGAAAAGTAGCAAGGGGTCTG No data
Right 1036191235 8:6671858-6671880 TGTTAGTCCTAGAATGGCAGAGG No data
1036191226_1036191235 16 Left 1036191226 8:6671819-6671841 CCCTTCTTCCAATGAGACCCAGA No data
Right 1036191235 8:6671858-6671880 TGTTAGTCCTAGAATGGCAGAGG No data
1036191232_1036191235 -1 Left 1036191232 8:6671836-6671858 CCCAGAAAAGTAGCAAGGGGTCT No data
Right 1036191235 8:6671858-6671880 TGTTAGTCCTAGAATGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036191235 Original CRISPR TGTTAGTCCTAGAATGGCAG AGG Intergenic
No off target data available for this crispr