ID: 1036191952

View in Genome Browser
Species Human (GRCh38)
Location 8:6678649-6678671
Sequence TGAATCACCGTGCCTGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036191952_1036191955 1 Left 1036191952 8:6678649-6678671 CCCTGGGCAGGCACGGTGATTCA No data
Right 1036191955 8:6678673-6678695 GCCTATAATCCCAGTGCTGTGGG No data
1036191952_1036191962 17 Left 1036191952 8:6678649-6678671 CCCTGGGCAGGCACGGTGATTCA No data
Right 1036191962 8:6678689-6678711 CTGTGGGAGGCCAAGGTGGATGG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
1036191952_1036191959 10 Left 1036191952 8:6678649-6678671 CCCTGGGCAGGCACGGTGATTCA No data
Right 1036191959 8:6678682-6678704 CCCAGTGCTGTGGGAGGCCAAGG 0: 19
1: 967
2: 6295
3: 99201
4: 222524
1036191952_1036191957 4 Left 1036191952 8:6678649-6678671 CCCTGGGCAGGCACGGTGATTCA No data
Right 1036191957 8:6678676-6678698 TATAATCCCAGTGCTGTGGGAGG 0: 7
1: 468
2: 4984
3: 49636
4: 359945
1036191952_1036191954 0 Left 1036191952 8:6678649-6678671 CCCTGGGCAGGCACGGTGATTCA No data
Right 1036191954 8:6678672-6678694 TGCCTATAATCCCAGTGCTGTGG No data
1036191952_1036191961 13 Left 1036191952 8:6678649-6678671 CCCTGGGCAGGCACGGTGATTCA No data
Right 1036191961 8:6678685-6678707 AGTGCTGTGGGAGGCCAAGGTGG 0: 13
1: 584
2: 4146
3: 68943
4: 159613
1036191952_1036191964 28 Left 1036191952 8:6678649-6678671 CCCTGGGCAGGCACGGTGATTCA No data
Right 1036191964 8:6678700-6678722 CAAGGTGGATGGATCTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036191952 Original CRISPR TGAATCACCGTGCCTGCCCA GGG (reversed) Intergenic
No off target data available for this crispr