ID: 1036191956

View in Genome Browser
Species Human (GRCh38)
Location 8:6678674-6678696
Sequence TCCCACAGCACTGGGATTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 410098
Summary {0: 9, 1: 470, 2: 4862, 3: 50062, 4: 354695}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036191956_1036191967 26 Left 1036191956 8:6678674-6678696 CCTATAATCCCAGTGCTGTGGGA 0: 9
1: 470
2: 4862
3: 50062
4: 354695
Right 1036191967 8:6678723-6678745 CCCGGAGTTCAAGACAAGCCTGG No data
1036191956_1036191964 3 Left 1036191956 8:6678674-6678696 CCTATAATCCCAGTGCTGTGGGA 0: 9
1: 470
2: 4862
3: 50062
4: 354695
Right 1036191964 8:6678700-6678722 CAAGGTGGATGGATCTTTTCAGG No data
1036191956_1036191969 27 Left 1036191956 8:6678674-6678696 CCTATAATCCCAGTGCTGTGGGA 0: 9
1: 470
2: 4862
3: 50062
4: 354695
Right 1036191969 8:6678724-6678746 CCGGAGTTCAAGACAAGCCTGGG No data
1036191956_1036191962 -8 Left 1036191956 8:6678674-6678696 CCTATAATCCCAGTGCTGTGGGA 0: 9
1: 470
2: 4862
3: 50062
4: 354695
Right 1036191962 8:6678689-6678711 CTGTGGGAGGCCAAGGTGGATGG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
1036191956_1036191965 8 Left 1036191956 8:6678674-6678696 CCTATAATCCCAGTGCTGTGGGA 0: 9
1: 470
2: 4862
3: 50062
4: 354695
Right 1036191965 8:6678705-6678727 TGGATGGATCTTTTCAGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036191956 Original CRISPR TCCCACAGCACTGGGATTAT AGG (reversed) Intergenic
Too many off-targets to display for this crispr