ID: 1036191962

View in Genome Browser
Species Human (GRCh38)
Location 8:6678689-6678711
Sequence CTGTGGGAGGCCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269561
Summary {0: 14, 1: 1357, 2: 26592, 3: 81400, 4: 160198}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036191952_1036191962 17 Left 1036191952 8:6678649-6678671 CCCTGGGCAGGCACGGTGATTCA No data
Right 1036191962 8:6678689-6678711 CTGTGGGAGGCCAAGGTGGATGG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
1036191953_1036191962 16 Left 1036191953 8:6678650-6678672 CCTGGGCAGGCACGGTGATTCAT No data
Right 1036191962 8:6678689-6678711 CTGTGGGAGGCCAAGGTGGATGG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
1036191950_1036191962 22 Left 1036191950 8:6678644-6678666 CCATCCCCTGGGCAGGCACGGTG No data
Right 1036191962 8:6678689-6678711 CTGTGGGAGGCCAAGGTGGATGG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
1036191951_1036191962 18 Left 1036191951 8:6678648-6678670 CCCCTGGGCAGGCACGGTGATTC No data
Right 1036191962 8:6678689-6678711 CTGTGGGAGGCCAAGGTGGATGG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
1036191956_1036191962 -8 Left 1036191956 8:6678674-6678696 CCTATAATCCCAGTGCTGTGGGA 0: 9
1: 470
2: 4862
3: 50062
4: 354695
Right 1036191962 8:6678689-6678711 CTGTGGGAGGCCAAGGTGGATGG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036191962 Original CRISPR CTGTGGGAGGCCAAGGTGGA TGG Intergenic
Too many off-targets to display for this crispr