ID: 1036196184

View in Genome Browser
Species Human (GRCh38)
Location 8:6717055-6717077
Sequence TTCTGCCTTACTCTTGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036196184 Original CRISPR TTCTGCCTTACTCTTGAGGG TGG (reversed) Intronic
900536554 1:3180646-3180668 CGCTGCCTTGCCCTTGAGGGAGG + Intronic
903069777 1:20721463-20721485 TTCTGCTTTACTCCTGGGGCAGG - Intronic
920657212 1:207886016-207886038 TGCTGTCTTAATCTTGAGGGTGG + Intronic
921355049 1:214278096-214278118 TGCTGGCTTATTCTTGAGGGTGG - Intergenic
1064422638 10:15203771-15203793 TTCTGCCTCACTGTTGAGCTGGG - Intergenic
1065925196 10:30428937-30428959 TTCAACCTTTCTCTGGAGGGGGG + Intergenic
1066239889 10:33523339-33523361 TTCTGGATTAATCTTGATGGTGG - Intergenic
1066326382 10:34363959-34363981 TTCTGCTGTTCTCTGGAGGGTGG - Intronic
1067998222 10:51300550-51300572 TTTTGCTTTACTCTTGAGTGTGG + Intronic
1068590932 10:58852391-58852413 TTCTGCCTCTCTCTTGCTGGAGG - Intergenic
1071678488 10:87680446-87680468 TTCTGTCTTACAGTTCAGGGTGG + Intronic
1072503136 10:96039123-96039145 CACTGCCTTACTCTGGATGGAGG - Intergenic
1075161895 10:120031642-120031664 CTCGGCCTTACTCATGAGGCAGG - Intergenic
1081974401 11:47223031-47223053 TTTTGCCTTTATTTTGAGGGAGG + Intronic
1081984684 11:47293037-47293059 TTCTGCCATACCATTGTGGGTGG + Intronic
1093023768 12:14227433-14227455 TTCTTCCTAACTCATGAGGCTGG - Intergenic
1097030082 12:56083594-56083616 TTCTGCCTATCGCTTGTGGGAGG + Intronic
1100819613 12:98419106-98419128 TCCTGCCCTTCTCTTTAGGGTGG + Intergenic
1103999054 12:124848698-124848720 TTCTGCCGTTCTCACGAGGGAGG - Intronic
1104546311 12:129716101-129716123 TTCTGCCTTTCTCTGGAGTTAGG - Intronic
1104710602 12:130982995-130983017 TTCTGGCTCATTCTTAAGGGAGG + Intronic
1106642004 13:31594321-31594343 TTCTACCATGCTCTTGAGTGTGG - Intergenic
1107331306 13:39304045-39304067 TTCTGCTTTTCTCTTGGTGGGGG - Intergenic
1108726601 13:53190145-53190167 TTCTGCCTTACTTTAGAGCTAGG - Intergenic
1108771912 13:53713001-53713023 TTCTCTCTTTCTCTGGAGGGCGG + Intergenic
1108861589 13:54867223-54867245 TTATGCCTAACACTTGTGGGGGG - Intergenic
1109417874 13:62067661-62067683 TTCTGCCTTATTCTTTGGGAAGG + Intergenic
1110036625 13:70694298-70694320 TTCTTCTGTAATCTTGAGGGAGG - Intergenic
1111647980 13:91056133-91056155 TGCTGCCTTAATCTTGATGGAGG - Intergenic
1112053722 13:95670794-95670816 TTCTGTCTTTCTCTTCAGGATGG + Intergenic
1112082347 13:95987055-95987077 ATCTGCCTCACTGTTGAGGTAGG - Intronic
1112585272 13:100713447-100713469 ATCTGCCTTCCTTTTGAAGGTGG + Intergenic
1112789015 13:102983054-102983076 TACTGCCTGACAGTTGAGGGTGG + Intergenic
1112962090 13:105139168-105139190 TACTGCCTTACTCTAGAGAGAGG + Intergenic
1115770361 14:36660099-36660121 CTCTGCCTTAGGCTTGCGGGAGG - Intronic
1116277809 14:42859418-42859440 ATCTTCCTTAGTTTTGAGGGAGG + Intergenic
1117547932 14:56808588-56808610 GTCTACCTTACTCTGGGGGGAGG + Intronic
1117765327 14:59076031-59076053 TTCTACCTTAGTCTTAGGGGAGG + Intergenic
1119270515 14:73300075-73300097 TTCTGCTTTACTATTGGGAGAGG - Intronic
1119434109 14:74586777-74586799 TTCTGCCTTGCTAAGGAGGGTGG - Intronic
1120977301 14:90260341-90260363 TTCTACCTCACTCTTGAGTGTGG + Intronic
1123905217 15:24914246-24914268 TTCTTCCTGGCTCTTGTGGGAGG - Intronic
1126309017 15:47294591-47294613 TTCTGACTTCCTCCTGAGGTAGG + Intronic
1127627609 15:60795649-60795671 TTCTGCCTTACTCACCATGGAGG - Intronic
1128779593 15:70350343-70350365 TTTTGCCTTAGTCTTGGGGTAGG + Intergenic
1131802424 15:96084891-96084913 TTCTGCCTAAACCTTGAGGACGG + Intergenic
1138563553 16:57816355-57816377 TCCTGGCTTCCTCTTGAGGAAGG + Intronic
1139891003 16:70253312-70253334 TTCTGCCATGCTCTTCACGGTGG - Exonic
1144955533 17:19017130-19017152 TTGTGCCTTGCTCCTCAGGGAGG - Intronic
1145306479 17:21678189-21678211 TTCTGCCTGGCTCATGAGGCTGG - Intergenic
1146017550 17:29245933-29245955 TTATGCATTACTCCTGAGGGAGG + Intergenic
1147646392 17:42036827-42036849 CTCTGTCTAACTCTGGAGGGTGG + Intronic
1150972475 17:70044288-70044310 TTCAGCCTTACTCTTGGCTGTGG - Intergenic
1151101312 17:71558829-71558851 TGCAGCCTTACTTTTGAGGTTGG - Intergenic
1155419544 18:25640084-25640106 TCCTGCCTGAATCTGGAGGGAGG - Intergenic
1156430314 18:37065928-37065950 ATCTGCCTTACTGTTGAGCTTGG - Intronic
1158233236 18:55282888-55282910 TTCTCAATTACTCTTGTGGGAGG - Intronic
1159175339 18:64826582-64826604 TTCTGCCCAACGTTTGAGGGAGG + Intergenic
1161586618 19:5109192-5109214 TTCCCCCTTCCTCTTGAGGTTGG + Intronic
1163339470 19:16695734-16695756 TTTTCCCTAATTCTTGAGGGTGG + Intergenic
1164845680 19:31430696-31430718 TTCTTCCTTACGTTGGAGGGTGG - Intergenic
1165953538 19:39488206-39488228 GTCAGCCTTACTCTTGAGGAAGG - Exonic
1167232382 19:48293084-48293106 TTCTGCCTCACTCCTGGAGGAGG + Intergenic
925920254 2:8633245-8633267 TTCTGCCTTCCTCTGGCAGGTGG - Intergenic
927633549 2:24794273-24794295 GTATGCATTACTCTTGAGGGAGG + Intronic
929939494 2:46322110-46322132 TTCTTCCTTCTTCTTGGGGGAGG + Intronic
933523929 2:83411529-83411551 TTCTACCATACTTTTGAAGGTGG - Intergenic
936259551 2:110947352-110947374 TTCTGCCTTACAGTGGAGAGGGG + Intronic
937354948 2:121192444-121192466 GGCTGCCTGACTCTTGAGGAGGG - Intergenic
938219491 2:129553389-129553411 TTCTTCCGGACTCTTGAAGGTGG + Intergenic
938368664 2:130755628-130755650 CTCTGCCGCAGTCTTGAGGGAGG - Intronic
939816200 2:146900316-146900338 TACTGCCTTACTCAAGAGGATGG - Intergenic
944508672 2:200442544-200442566 CTCTGTCTTACTCTTTAGTGTGG + Intronic
948408374 2:237740028-237740050 TTCTCACTGGCTCTTGAGGGTGG - Intronic
948520951 2:238537418-238537440 TTCTGCATTATTCCTGAGGTCGG - Intergenic
948554933 2:238802586-238802608 TTCGGCCTTACTGATGAGGTGGG - Intergenic
1169246036 20:4025619-4025641 TCCTGACTTACTCTTGAAGTAGG + Intergenic
1170311555 20:14997678-14997700 TTCTGTCTTTCCCTTCAGGGTGG - Intronic
1171147952 20:22802323-22802345 TTAGGCCTTATTCTTGGGGGTGG + Intergenic
1171397157 20:24842803-24842825 TCCTCCCCTACTCTTGAGGATGG - Intergenic
1172480120 20:35266516-35266538 ATCTGCCCTACTCTAGAGGCTGG - Intronic
1172767777 20:37359830-37359852 TGCTGCCTTAGTCTAGGGGGTGG + Intronic
1173051421 20:39565785-39565807 TTCTGCCTCACTCATGCTGGAGG - Intergenic
1174746373 20:53067253-53067275 TTCTGCCACATTCTTAAGGGAGG + Intronic
1174845270 20:53937277-53937299 TTCTGCCTTACTTTAGAATGGGG + Intronic
1175648702 20:60697946-60697968 CTCTGCCTTGCACTTGAGCGTGG - Intergenic
1175720164 20:61280922-61280944 TGCTGCGTTCCTCTTTAGGGTGG + Intronic
1175729690 20:61345974-61345996 TTCTCCCTTCCTCATGCGGGTGG + Intronic
1178463109 21:32821002-32821024 TTCAGTGTTACTCTTAAGGGCGG - Intergenic
1179171528 21:38976712-38976734 TCCTGCTTTACTCTTGGGAGGGG - Intergenic
1181681830 22:24500663-24500685 TTCTGCCTTAATCCTCAGGGCGG + Intronic
953728381 3:45421660-45421682 TTCTGCCTTAAGTTTGGGGGAGG - Intronic
958037919 3:88191731-88191753 TTCTGCATTACTTTTTAGGGAGG - Intergenic
958772590 3:98443584-98443606 CTCTGCCTTACCAATGAGGGGGG + Intergenic
959454067 3:106537473-106537495 TTCTGGTTTAGTCTTGAGGGGGG - Intergenic
962881936 3:139586546-139586568 TTCTGCCATCCCCTTGAAGGAGG - Intronic
967772329 3:193347922-193347944 TACTGCCTGACTCACGAGGGAGG - Intronic
970910380 4:21268548-21268570 GTCTGACTTTGTCTTGAGGGAGG + Intronic
971029892 4:22624644-22624666 TTCAGCCTGATTTTTGAGGGAGG + Intergenic
976328044 4:83795369-83795391 GTCTGCCTTACTATTGAGGTTGG + Intergenic
983043009 4:162953053-162953075 TTCTCCCTTAAACTTGAAGGTGG - Intergenic
983384171 4:167037123-167037145 TTCTCCCCTACTTTTGAGGATGG - Intronic
987304290 5:16623223-16623245 TTCTGGATTACTCTGGAGGTCGG - Intergenic
988064727 5:26219267-26219289 TTGTGTCTTTCTCTTCAGGGTGG - Intergenic
988935588 5:36079407-36079429 TTCTGCCATCCTCATCAGGGAGG - Intergenic
991433198 5:66569324-66569346 TTCGGCCTTACAATTGTGGGAGG + Intergenic
992361896 5:76047264-76047286 TCATGGGTTACTCTTGAGGGTGG - Intergenic
993176791 5:84496786-84496808 TTCTCCCTTTCCCTTGAGTGTGG - Intergenic
994127042 5:96179622-96179644 TGCTGACTCACACTTGAGGGAGG + Intergenic
1000192321 5:158923456-158923478 TTTTGCCTTATTATGGAGGGTGG + Intronic
1000761173 5:165226547-165226569 TCCTGCCTTAGTCTGGACGGAGG - Intergenic
1002878371 6:1231063-1231085 CACTGCCTCACTCTTGTGGGGGG + Intergenic
1003309593 6:4957821-4957843 CTCTCCCTTCCTCTAGAGGGCGG - Intergenic
1008641401 6:53466197-53466219 ATCTGCCTTACTCCTGAGAGAGG + Intergenic
1008889616 6:56472619-56472641 TTCTGCCTTATTCTCTAGGAAGG - Intronic
1011386204 6:86801457-86801479 TTGTGTCTTTCCCTTGAGGGTGG + Intergenic
1012893077 6:104919191-104919213 TTCTGCCCTCATTTTGAGGGGGG - Intergenic
1013733633 6:113200842-113200864 TTTTGCCTGACTCTGGAGGCTGG - Intergenic
1014292131 6:119570973-119570995 TGCTGCCTTCTTCTTCAGGGTGG - Intergenic
1015263617 6:131266105-131266127 CTCTGGCTTACTCTTCAGGAAGG + Intronic
1015460654 6:133487469-133487491 GTCTTCCTTCCACTTGAGGGAGG + Intronic
1015840895 6:137476373-137476395 TTCTGACCTACTCTTGAGATAGG - Intergenic
1016657030 6:146531044-146531066 TTCTTCATTCCTCTTGAGTGAGG + Intergenic
1016668381 6:146671286-146671308 TTGTGCAGTATTCTTGAGGGGGG + Intronic
1017352286 6:153456646-153456668 TTCTGCCTTAATTTTGATGGTGG + Intergenic
1021604159 7:22393765-22393787 TTCTGATTTTCTCTTGATGGTGG - Intergenic
1022489446 7:30805385-30805407 TTCTGCCCCACTCTTGACTGTGG - Intronic
1023854424 7:44173510-44173532 TTCTGCCTTAATGGTGATGGTGG + Intronic
1023893042 7:44407232-44407254 TTCTCCCATTCTCTTGAGTGTGG - Intronic
1028307917 7:89289950-89289972 TTCTTCCTTTCACTTGAGGAAGG + Intronic
1032138705 7:129307169-129307191 TTGTGCCTTTCCCTTCAGGGTGG + Intronic
1032388861 7:131542801-131542823 TACTGCCATGCTCTAGAGGGAGG - Intronic
1033233668 7:139621242-139621264 TTCAGCCTTACTCGTGAAGTAGG - Intronic
1036196184 8:6717055-6717077 TTCTGCCTTACTCTTGAGGGTGG - Intronic
1037233470 8:16688303-16688325 TTCTCTCTCACTCTTGAGAGAGG + Intergenic
1047051703 8:121119918-121119940 TTCTGCCCTAGTCATGTGGGAGG - Intergenic
1051069226 9:13143230-13143252 TTCTCCCTTACTCTTCAGAAGGG + Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1185819012 X:3183982-3184004 TGCTGTCTTAATCTCGAGGGAGG - Intergenic
1189523073 X:41790544-41790566 TTCTGCCTTTATTTTGAGAGTGG - Intronic
1189914903 X:45847445-45847467 TTCTGCCTTACAGCTGAGGAGGG - Intergenic
1191654111 X:63577263-63577285 TTCAGCCTTGCCCTTGTGGGAGG - Intergenic
1192802600 X:74480624-74480646 TACTGACTTTTTCTTGAGGGTGG - Intronic
1196507231 X:116461850-116461872 TTCTGCCTGGCTATTGAGTGTGG + Exonic
1198665738 X:139020453-139020475 GTCAGCTTTACTCTTGAGAGGGG - Intronic
1199999663 X:153052396-153052418 TTCAGCCTTTCTCTTGGGGATGG + Intergenic
1200107129 X:153720727-153720749 CTGTGTCTTTCTCTTGAGGGAGG - Intronic
1201893355 Y:18967383-18967405 TTCCTCCTCACTCTTGAGGATGG + Intergenic