ID: 1036197499

View in Genome Browser
Species Human (GRCh38)
Location 8:6733200-6733222
Sequence CTTTGTCTCCGGAGGGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 228}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036197499_1036197508 3 Left 1036197499 8:6733200-6733222 CCTGGTTCCCTCCGGAGACAAAG 0: 1
1: 0
2: 0
3: 10
4: 228
Right 1036197508 8:6733226-6733248 CATGATCACCGGGGCGACTTGGG No data
1036197499_1036197507 2 Left 1036197499 8:6733200-6733222 CCTGGTTCCCTCCGGAGACAAAG 0: 1
1: 0
2: 0
3: 10
4: 228
Right 1036197507 8:6733225-6733247 CCATGATCACCGGGGCGACTTGG No data
1036197499_1036197505 -6 Left 1036197499 8:6733200-6733222 CCTGGTTCCCTCCGGAGACAAAG 0: 1
1: 0
2: 0
3: 10
4: 228
Right 1036197505 8:6733217-6733239 ACAAAGCACCATGATCACCGGGG No data
1036197499_1036197503 -8 Left 1036197499 8:6733200-6733222 CCTGGTTCCCTCCGGAGACAAAG 0: 1
1: 0
2: 0
3: 10
4: 228
Right 1036197503 8:6733215-6733237 AGACAAAGCACCATGATCACCGG No data
1036197499_1036197504 -7 Left 1036197499 8:6733200-6733222 CCTGGTTCCCTCCGGAGACAAAG 0: 1
1: 0
2: 0
3: 10
4: 228
Right 1036197504 8:6733216-6733238 GACAAAGCACCATGATCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036197499 Original CRISPR CTTTGTCTCCGGAGGGAACC AGG (reversed) Intronic
906008557 1:42501817-42501839 CTTTGTCTCAGAGGGGCACCCGG + Intronic
906215671 1:44036742-44036764 TTTTGTCACCAGAGGGCACCAGG - Intergenic
906714543 1:47956984-47957006 CTTTGTCTCAGAGGGGCACCCGG - Intronic
907005571 1:50910245-50910267 CTTTGTCTCAGAGGGGCACCCGG + Intronic
909396934 1:75181082-75181104 CTTTGTCTCAGAGGGGCACCTGG + Intergenic
909438399 1:75671014-75671036 CTTTGTCTCCTGAGTGACCTTGG - Intergenic
909807859 1:79893967-79893989 CTTTGTCTCAGAGGGGCACCCGG + Intergenic
910785983 1:90998325-90998347 CTTTGTCTCAGAGGGGTACCTGG - Intronic
910945754 1:92589894-92589916 CTTTGTCTCAGAGGGGTACCCGG - Intronic
910949908 1:92635042-92635064 CTTTGTCTCAGAGGGGTACCCGG + Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
915088910 1:153407746-153407768 CTTTGTCTCAGAGGGGCACCTGG - Intergenic
917207844 1:172596648-172596670 CTTTGTCTCAGAGGGGCACCCGG + Intronic
917764087 1:178198688-178198710 CTTTGTCTCAGAGGGGCACCTGG + Intronic
921149874 1:212391220-212391242 TTTTGTCTCAGAAGGGTACCTGG - Intronic
922424558 1:225480977-225480999 CATATTCTCCGGTGGGAACCAGG + Intergenic
922552277 1:226504644-226504666 CTTTGTCTCAGAGGGGCACCCGG + Intergenic
1063326697 10:5110393-5110415 CTTTGTCTCAGAAGAGTACCCGG - Intronic
1065649871 10:27876324-27876346 CTTTGTCTCAGAGGGGTACCCGG - Intronic
1066060407 10:31719037-31719059 CTTTGTCTCAGAGGGGTACCCGG + Intergenic
1067172512 10:43920144-43920166 CTTTGTCTCAGAGGGGCACCTGG + Intergenic
1067934051 10:50593062-50593084 CTCTGTTTTCGGAGGGAAGCTGG + Intronic
1068559531 10:58497982-58498004 CTTTGCCTTGGGAGGTAACCAGG - Intergenic
1074450785 10:113558103-113558125 CTTTGTCTCCTGCTGGAAGCTGG - Intronic
1078121714 11:8517110-8517132 CTTTGTCTCAGAGGGGCACCCGG - Intronic
1079463650 11:20707732-20707754 CTTTGTCTCAGAGGGGCACCTGG + Intronic
1079977052 11:27104870-27104892 CTTTGTCTCAGAGGGGTACCAGG - Intronic
1081768306 11:45628329-45628351 CTTTGTCTCAGAGGGGCACCTGG - Intergenic
1082966682 11:58973018-58973040 CTTTGTCTCAGAGGGGTACCTGG - Intronic
1084788784 11:71459988-71460010 GAGTGTCTCCGGAAGGAACCAGG - Intronic
1084890736 11:72235724-72235746 CTCTGTGTCCCGAGGGAGCCAGG + Exonic
1085162505 11:74361177-74361199 CTTTGTCTCAGAGGGGTACCCGG - Intronic
1085536500 11:77223566-77223588 CTTTGTCTCAGAGGGGCACCTGG + Intronic
1086529140 11:87763751-87763773 CTTTGTCTCAGAGGGGTACCCGG + Intergenic
1087243481 11:95806997-95807019 CTTAGTCTCAGAAGGGGACCCGG - Intronic
1088309162 11:108441600-108441622 CTTTGTCTCAGAGGGGCACCTGG - Intronic
1090924308 11:131236139-131236161 CTTTGCCTCCACAGGGATCCTGG + Intergenic
1093802376 12:23389444-23389466 CTTTGTCTCAGAGGGGCACCTGG - Intergenic
1094653570 12:32399937-32399959 CTGTGGCTCCTGAGGGCACCTGG - Intronic
1095105625 12:38230208-38230230 CTTTGTCTCAGAGGGGTACCCGG + Intergenic
1095533674 12:43221303-43221325 CTTTCTCTCCCCAGCGAACCTGG + Intergenic
1095827433 12:46545292-46545314 CTTTGTCTCAGAGGGGTACCTGG + Intergenic
1099086925 12:78257507-78257529 CTTCGTCTCAGGCGGGCACCTGG + Intergenic
1099792122 12:87349404-87349426 CTTTGTCTCCTCAGGCAGCCAGG - Intergenic
1100463500 12:94823564-94823586 CTTTGTCTCAGAGGGGCACCTGG - Intergenic
1101242979 12:102856612-102856634 CTTTGTCTCAGAGGGGTACCCGG - Intronic
1103216168 12:119202943-119202965 CTCTGCCTCCTGAGGGACCCTGG + Intronic
1103379944 12:120486431-120486453 CTCTGTCCCCTGAGAGAACCAGG + Intronic
1103851194 12:123934625-123934647 CTTTGTCTCAGGACTGTACCTGG + Exonic
1106708962 13:32311329-32311351 CTTCGTCTCCTGAGGGCACGGGG + Exonic
1106737922 13:32607423-32607445 CTTTGTCTCAGAGGGGCACCTGG + Intronic
1108627801 13:52248450-52248472 CTTTGTCTCAGAGGGGTACCCGG + Intergenic
1108658261 13:52558003-52558025 CTTTGTCTCAGAGGGGTACCCGG - Intergenic
1108892430 13:55277939-55277961 CTTTGTCTCAGAGGGGCACCCGG + Intergenic
1109446238 13:62445050-62445072 CTTAGTCTGTGGAAGGAACCTGG + Intergenic
1110510348 13:76343050-76343072 CTTTGTCTCAGAGGGGCACCAGG - Intergenic
1110652577 13:77959320-77959342 CTTCGTCTCAGAGGGGAACCTGG - Intergenic
1110737940 13:78960347-78960369 CTTTCTCTCCTGAGGCATCCTGG - Intergenic
1113018935 13:105860167-105860189 CTTGGTCTCCAGTGGGCACCAGG - Intergenic
1114240335 14:20860877-20860899 CTTTGTCTCAGAGGGGCACCTGG - Intergenic
1114579451 14:23744287-23744309 CTTTGTCTCAGTGGGGCACCCGG + Intergenic
1114581225 14:23762073-23762095 CTTTGTCTCAGAGGGGCACCTGG + Intergenic
1114677456 14:24453271-24453293 CTTTGTCTCAGAGGGGCACCTGG + Intergenic
1115869670 14:37785988-37786010 CTTTGTCTCAGAGGGGCACCCGG + Intronic
1119194650 14:72708473-72708495 CTTTGTCGCGGAAGGGAAGCTGG - Intronic
1122510689 14:102264825-102264847 CTGTGGCTCCGGAGGGAGCCTGG - Intronic
1123167728 14:106342576-106342598 CTTGGTGTCCTGAGGGAGCCTGG + Intergenic
1123170354 14:106367287-106367309 CTTGGTGTCCTGAGGGAGCCTGG + Intergenic
1126100327 15:45114802-45114824 GATTGTCTCCTGAGGGACCCAGG + Intronic
1126239552 15:46425686-46425708 CTTTGTCTCAGCGGGGCACCTGG - Intergenic
1127057213 15:55143944-55143966 CTTTGTCTCAGAGGGGTACCTGG - Intergenic
1128236877 15:66073629-66073651 CTGTGTCTCCCTGGGGAACCAGG - Intronic
1128549848 15:68591046-68591068 CTCTGTCTCCAGGGGGATCCTGG + Intronic
1130079702 15:80721839-80721861 CTTTGTTTCTGGAGGGAAGGAGG + Intronic
1131051541 15:89351477-89351499 CTCTGTCCTCGGAAGGAACCTGG - Intergenic
1132586739 16:708866-708888 CCTTGGCTCCGGAGGGCACCTGG + Intronic
1133013164 16:2925835-2925857 CGTTGTCTCCGGAGCCGACCAGG + Intronic
1133015250 16:2936747-2936769 CTTTGTCCCCAGAGGGCCCCGGG + Intronic
1137697873 16:50474455-50474477 ATATGTCATCGGAGGGAACCTGG + Intergenic
1140583100 16:76254670-76254692 CTTTGTCTCAGAGGGGTACCCGG + Intergenic
1143042947 17:4052858-4052880 CTTTGTCTCGGGAGGGCGGCGGG + Intronic
1145004200 17:19328315-19328337 CCTTGTCTGAGGAGGGAGCCTGG + Intronic
1149931994 17:60766567-60766589 CTTTGTCTCAGAGGGGCACCCGG + Intronic
1158145659 18:54309460-54309482 CTTTGTCTCAGAGGGGCACCCGG + Intronic
1164406182 19:27949057-27949079 CTTTGTCTCAGAGGGGCACCTGG + Intergenic
1164415713 19:28045125-28045147 CTGTGCCTCAGGAGGGGACCTGG - Intergenic
1166674538 19:44731998-44732020 CTATGTCTCCGGAGGGCAGGTGG + Intergenic
1168070970 19:53951539-53951561 CTTTGCCTCCCCAAGGAACCCGG - Intergenic
1168717908 19:58539842-58539864 CTCTGTCTGAGGAGGGAAGCAGG - Intergenic
926119609 2:10234918-10234940 CCTTGTCTCAGGAGGAAACCAGG + Intergenic
926917663 2:17908822-17908844 CTTTGTCTCAGAGGGGTACCCGG + Intronic
927447065 2:23172302-23172324 CTTCGTCTCAGAAGGGCACCTGG - Intergenic
927558080 2:24049890-24049912 CCCTGGCTCCGGAGGGAGCCCGG - Intronic
930467598 2:51774437-51774459 CTTTGTCTCAGAGGGGTACCTGG + Intergenic
931997961 2:67857070-67857092 CTTTGTCTCTGCAGGTGACCTGG + Intergenic
934882886 2:97998462-97998484 ATGTGTCTCAGGAGAGAACCAGG + Intergenic
935709898 2:105889114-105889136 CTCTGCCTCCAGAGGGAGCCAGG - Intronic
939074827 2:137587698-137587720 CTTTGTCTCAGAGGGGTACCTGG + Intronic
941380493 2:164786666-164786688 CTCTGTCTCCTGAGGGAGACAGG - Intronic
942708073 2:178799615-178799637 CTTTGGCTTCGGAGGAATCCTGG + Exonic
942859354 2:180590971-180590993 CTTTGTCTCAGAGGGGTACCCGG + Intergenic
942899727 2:181100178-181100200 CTTTGTCTCAGAGGGGCACCTGG + Intergenic
943125357 2:183789388-183789410 CTTTGTCTCAGAGGGGTACCTGG - Intergenic
944466321 2:200003527-200003549 CTTTCTCTCAGGAGGAAAGCAGG + Intronic
944612943 2:201430191-201430213 CTTTGTCTCAGAGGGGTACCCGG + Intronic
945403993 2:209423752-209423774 CTTTGTCGCGGGAGGGGACCAGG + Intergenic
948206903 2:236167365-236167387 CTTGGTCTCCCGCGGGAACCCGG + Intronic
1169660512 20:7973582-7973604 CTTTGTCTTCTGAGGGGACAGGG - Intergenic
1173543794 20:43876499-43876521 CTTTGTCTCAGAGGGGCACCGGG + Intergenic
1174295244 20:49540889-49540911 CTTTGTCTGCACAGGGATCCAGG - Intronic
1174295525 20:49542565-49542587 CTTTGTCTGCACAGGGACCCAGG + Intronic
1176010841 20:62894171-62894193 CATCTTCTGCGGAGGGAACCTGG + Exonic
1179807957 21:43852031-43852053 CTGTGACTGCGGAGGGAACTGGG - Intergenic
1179808028 21:43852404-43852426 CTGTGACTGCGGAGGGAACTGGG - Intergenic
1180601823 22:17024876-17024898 CTTTGTCTCAGAGGGGCACCTGG - Intergenic
1180958368 22:19751127-19751149 CTGGGTCTCAGGAGGGAACCGGG + Intergenic
1182789884 22:32942225-32942247 CTTTGTCTCAGAGGGGTACCTGG - Intronic
1182998007 22:34832097-34832119 CTTTGAATCAGGATGGAACCAGG + Intergenic
1183949993 22:41347499-41347521 CTTGGCCTCCGGAGTGAACTTGG + Intronic
1185181641 22:49366773-49366795 GTGTGTATCCGCAGGGAACCGGG + Intergenic
1185365514 22:50434858-50434880 CTTGCTCTCCGAAGTGAACCTGG + Intronic
950490188 3:13299833-13299855 CTCTGTCTCTGCAGGAAACCTGG + Intergenic
952395888 3:32920576-32920598 CTTTGTCTCAGGTGGGAACTGGG - Intergenic
952586994 3:34904882-34904904 CTTTGTCTCAGAGGGGCACCTGG - Intergenic
954828004 3:53391895-53391917 CTTTGTCTCAGAGGGGTACCTGG - Intergenic
955361600 3:58280968-58280990 CTTTGTCTCAGAGGGGCACCCGG + Intronic
955630238 3:60965801-60965823 CTTTGTCTCAGAGGGGTACCTGG + Intronic
956291629 3:67666819-67666841 CTTTGTCTCCTGAAGGCAACTGG - Intergenic
958773563 3:98455001-98455023 CTTTATTTCTGGAGGGAACATGG - Intergenic
961325435 3:126106612-126106634 CCTGGCCTCCGAAGGGAACCAGG + Intronic
961522618 3:127475680-127475702 CTTTGTCCTTGGAGGGAAGCTGG + Intergenic
961958842 3:130832583-130832605 CTTTGTCTCAGAGGGGTACCCGG - Intergenic
962287650 3:134101425-134101447 CTTTGTCTCAGAGGGGTACCTGG + Intronic
962460250 3:135604997-135605019 CTTTGTCTCAGAGGGGTACCTGG - Intergenic
962995409 3:140622919-140622941 CTTTGTCTCAGAGGGGTACCCGG - Intergenic
963109106 3:141670673-141670695 CTTTGTCTCAGAGGGGTACCAGG - Intergenic
964243250 3:154620122-154620144 CTTTGTCTCAGAGGGGTACCTGG - Intergenic
965818885 3:172665353-172665375 CTTTGTCTCAGAGGGGCACCTGG + Intronic
970972208 4:21997406-21997428 CTTTGTCTCAGAGGGGAACCCGG - Intergenic
972416768 4:38848062-38848084 CTTTGTCTCAGAGGGGTACCTGG - Intronic
974287863 4:59892726-59892748 CTTTGTCTCAGAGGGGTACCTGG - Intergenic
974774530 4:66462712-66462734 CTTTGTCTCAGAGGGGCACCTGG + Intergenic
974967042 4:68773577-68773599 CTTTGTCTCAGAGGGGTACCTGG + Intergenic
975034217 4:69661004-69661026 CTTTGTCTCAGAGGGGCACCTGG + Intergenic
975821577 4:78276677-78276699 CTTTGTCTCAGAGGGGCACCCGG + Intronic
978363645 4:107957452-107957474 CTTTGTCTCAGAGGGGCACCCGG - Intergenic
981869473 4:149468753-149468775 CTTTGTCTCAGAGGGGCACCTGG - Intergenic
983582038 4:169318461-169318483 CTTTGTCTCAGAGGGGTACCCGG - Intergenic
983627301 4:169814814-169814836 CTTTGTCTAGAGAGGAAACCAGG + Intergenic
983681924 4:170363242-170363264 CTTTGTCTCAGAAGGGCACCTGG + Intergenic
987122616 5:14781307-14781329 CTTTGACTCCTGAAGGGACCAGG - Intronic
988314341 5:29603751-29603773 CTTTGTCTCAGCGGGGCACCTGG - Intergenic
988416108 5:30948514-30948536 CTTTGTCTCAGAGGGGTACCCGG - Intergenic
990239250 5:53800119-53800141 CTTTGTCTCAGAGGGGCACCCGG - Intergenic
990487130 5:56270242-56270264 CTGAGTCTCTGGAGGGAGCCTGG - Intergenic
990539898 5:56761765-56761787 CTCTGTCTCTGATGGGAACCAGG + Intergenic
992811800 5:80396480-80396502 CTTTGTCTCAGAGGGGTACCTGG + Intergenic
993068777 5:83133251-83133273 CTTTGTCTCAGAGGGGCACCTGG + Intronic
993742312 5:91556141-91556163 CTTTGTCTCAGAGGGGCACCCGG - Intergenic
994033521 5:95172269-95172291 CTTTGTCTCAGAGGGGTACCTGG + Intronic
994861248 5:105198639-105198661 CTTTGTCTCAGAGGGGCACCCGG - Intergenic
995203980 5:109458020-109458042 TTTTGTCTCAGGGGGGTACCCGG - Intergenic
995962733 5:117863136-117863158 CTATGTCTACTGAGGGAACTAGG - Intergenic
997137812 5:131344778-131344800 CTTTGTCTCAGAGGGGCACCTGG - Intronic
998047708 5:139002791-139002813 CTAGTTCTCAGGAGGGAACCGGG - Intronic
999271888 5:150301573-150301595 CTATGTCTCCTGAGGGATTCAGG - Intronic
1000144815 5:158444161-158444183 CTTTGTCTCAGAGGGGTACCCGG + Intergenic
1001372533 5:171220264-171220286 CTTTGTCTCAGAGGGGCACCCGG + Intronic
1002273170 5:178086304-178086326 CAGTGTCTCCCGAGGGTACCTGG + Intergenic
1003782467 6:9444502-9444524 CTTTGTCTCAGAGGGGTACCCGG - Intergenic
1004150384 6:13113922-13113944 CTTTTTCTCCAGTTGGAACCTGG - Intronic
1005193833 6:23259643-23259665 CTTTGTCTCAGAGGGGCACCCGG + Intergenic
1008164257 6:48116444-48116466 CATTGTCTCAGATGGGAACCTGG + Intergenic
1010282176 6:74035071-74035093 CTTTGTCTCAGAGGGGCACCCGG + Intergenic
1010286526 6:74084404-74084426 CTTTGTCTCAGAGGGGCACCGGG + Intergenic
1011139059 6:84133223-84133245 CTTTGTCTCAGAGGGGCACCCGG + Intronic
1011524978 6:88254361-88254383 CTTTGTCTCAGAGGGGCACCCGG - Intergenic
1012459797 6:99447824-99447846 CTTTGTCTCAGATGGGTACCCGG - Intronic
1012481838 6:99676164-99676186 CTTTGTCTCAGAGGGGTACCCGG + Intergenic
1012941066 6:105415756-105415778 CTTTGTCTCAGAGGGGAACCTGG - Intergenic
1013168618 6:107616335-107616357 CTTAGTCTCAGAAGGGAGCCTGG - Intronic
1014423012 6:121267884-121267906 CTTCATCTCAGGAGGGCACCCGG - Intronic
1015811331 6:137164597-137164619 CTGAGTCTCCGGAGGCAGCCGGG - Intronic
1016875798 6:148863866-148863888 CTTTGTCTCAGAGGGGTACCCGG + Intronic
1019811633 7:3169271-3169293 CTCTGTCTCCGGACTGACCCCGG + Intronic
1020618547 7:10490711-10490733 CTTTCTCTCCCCTGGGAACCAGG - Intergenic
1020818738 7:12939469-12939491 CTTTGTCTCAGAGGGGCACCTGG + Intergenic
1021342221 7:19479395-19479417 CTTTGTCTCAGAGGGGCACCTGG + Intergenic
1021379832 7:19954071-19954093 CTTTGTCTCAGAGGGGCACCCGG + Intergenic
1022339749 7:29456870-29456892 CTTTGTCTCCAGAAAGCACCAGG + Intronic
1024817429 7:53287719-53287741 CTTTGTCTCAGAGGGGCACCCGG + Intergenic
1027447269 7:78288728-78288750 CTTTGTCTCAGAGGGGCACCCGG - Intronic
1028013535 7:85679208-85679230 CTTTGTCTCAGAGGGGCACCTGG + Intergenic
1028050121 7:86174692-86174714 CTTTGTCTCAGAGGGGCACCCGG - Intergenic
1029057455 7:97761176-97761198 CTTTGTCTCAGAGGGGCACCCGG - Intergenic
1030409636 7:109159348-109159370 CTTTGGCTCCTGAAGAAACCAGG + Intergenic
1034508642 7:151517526-151517548 CTTAGTCTCCGGTGGGATACAGG - Intronic
1036197499 8:6733200-6733222 CTTTGTCTCCGGAGGGAACCAGG - Intronic
1036516187 8:9446670-9446692 CTTTGTCTCAGTGGGGTACCTGG + Intergenic
1036752875 8:11454466-11454488 CTTTGTCTCCGGTTGAAATCAGG - Intronic
1037578518 8:20230637-20230659 CTGTGGCTCCTGAGGGACCCAGG + Intergenic
1037641053 8:20743457-20743479 CTTTGTCTCAGAGGGGTACCTGG - Intergenic
1040962374 8:53048507-53048529 CTTTGTCTCAGAGGGGTACCTGG + Intergenic
1042187692 8:66153525-66153547 CTCTGTCTCCACAGGAAACCAGG + Intronic
1042394573 8:68277066-68277088 CTTTGTCTCAGAGGGGTACCTGG - Intergenic
1043876698 8:85493684-85493706 CATTGGCTCCTGAAGGAACCAGG - Intergenic
1044292685 8:90491402-90491424 CTTTGTCTCAGAGGGGTACCTGG + Intergenic
1045239941 8:100391393-100391415 CTTGGTCTCTGTAGGGCACCTGG - Intronic
1045504431 8:102768615-102768637 CTTTGCCTCAGGAGGTAAGCTGG - Intergenic
1045712220 8:104998237-104998259 CTTTGTTTCCTGAGAGACCCAGG + Intronic
1048163453 8:132041231-132041253 CTGTGTCTCTGGATGGATCCTGG + Intronic
1048397941 8:134032672-134032694 CTTTGTCCCTGGGGGGAACTGGG - Intergenic
1050497876 9:6263678-6263700 CTTTGTCTCAGAGGGGCACCTGG + Intergenic
1051523416 9:18015786-18015808 ATTGGTCTCGGGAGGGATCCAGG - Intergenic
1054790687 9:69253844-69253866 CTTTGTTGCCAGAGGCAACCTGG - Intronic
1054997411 9:71407850-71407872 CTTTGTCTCAGAGGGGCACCCGG - Intronic
1056752529 9:89362891-89362913 CTTTGTCTCCGTGGGGAGACAGG + Intronic
1057175869 9:92998835-92998857 CTTTGTCTCAGAGGGGCACCCGG + Intronic
1059914267 9:119081229-119081251 CTTAGTCTCAGGTGGGGACCAGG + Intergenic
1062443238 9:136582887-136582909 CTTCGTCTCCAGAGAGACCCAGG + Intergenic
1062543496 9:137051824-137051846 CTTGGTCTCCGGGTGGCACCTGG - Intronic
1203573245 Un_KI270744v1:152233-152255 CTTTGTCTCAGAGGGGCACCTGG - Intergenic
1186743140 X:12538604-12538626 CTTTGTCTCAGAGGGGTACCCGG - Intronic
1186914573 X:14206252-14206274 CTTTGTCTCAGAGGGGCACCCGG + Intergenic
1190621641 X:52292548-52292570 CTTTGTCTCAGAAGAGTACCCGG - Intergenic
1191610227 X:63103662-63103684 CTTTGTCTCAGAAGAGCACCTGG - Intergenic
1192857226 X:75025179-75025201 CTTTGTCTCAGAGGGGTACCTGG + Intergenic
1192871747 X:75191339-75191361 CTTTGTCTCAGAGGGGTACCCGG + Intergenic
1194658177 X:96598395-96598417 CTTTGTCTCAGAGGGGTACCTGG - Intergenic
1194761690 X:97803277-97803299 CTTTGTCTCAGAGGGGCACCTGG + Intergenic
1195163624 X:102196422-102196444 CTTTGTCTCAGAGGGGCACCCGG + Intergenic
1195391355 X:104366003-104366025 CTTTGTCTCAGAGGGGCACCTGG + Intergenic
1195817520 X:108904417-108904439 CTTTGTCTCAGAGGGGTACCTGG - Intergenic
1197909240 X:131462358-131462380 CTTTGTCTCAGAGGGGTACCTGG - Intergenic
1198581878 X:138074161-138074183 CTTTGTCTCAGAGGGGCACCTGG - Intergenic
1199549611 X:149044356-149044378 CTGTGTCTCCTGAGGGAAGGAGG + Intergenic
1199778949 X:151040808-151040830 CTTCGTCTCAGGGGGGCACCTGG + Intergenic
1199914579 X:152325474-152325496 CTTTGTCTCAGAGGGGCACCTGG - Intronic
1201433586 Y:13931545-13931567 CTTTGCCTCCTGATGGAATCAGG + Intergenic