ID: 1036199379

View in Genome Browser
Species Human (GRCh38)
Location 8:6754600-6754622
Sequence CTGTGGAGCTCGCAGTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036199369_1036199379 10 Left 1036199369 8:6754567-6754589 CCATCGTGAGCCAGACCAGCTTC 0: 1
1: 0
2: 2
3: 5
4: 90
Right 1036199379 8:6754600-6754622 CTGTGGAGCTCGCAGTCTGGTGG No data
1036199371_1036199379 0 Left 1036199371 8:6754577-6754599 CCAGACCAGCTTCCTCTCGGCCC 0: 1
1: 0
2: 0
3: 25
4: 294
Right 1036199379 8:6754600-6754622 CTGTGGAGCTCGCAGTCTGGTGG No data
1036199372_1036199379 -5 Left 1036199372 8:6754582-6754604 CCAGCTTCCTCTCGGCCCCTGTG 0: 1
1: 0
2: 9
3: 49
4: 463
Right 1036199379 8:6754600-6754622 CTGTGGAGCTCGCAGTCTGGTGG No data
1036199368_1036199379 25 Left 1036199368 8:6754552-6754574 CCAGGTCAGGAGGTGCCATCGTG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1036199379 8:6754600-6754622 CTGTGGAGCTCGCAGTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036199379 Original CRISPR CTGTGGAGCTCGCAGTCTGG TGG Intronic
No off target data available for this crispr