ID: 1036200247

View in Genome Browser
Species Human (GRCh38)
Location 8:6764990-6765012
Sequence ACTGGCTCGTGGATAGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036200241_1036200247 9 Left 1036200241 8:6764958-6764980 CCAACATGGTTTTTATTCCTGCA No data
Right 1036200247 8:6764990-6765012 ACTGGCTCGTGGATAGATTTTGG No data
1036200243_1036200247 -8 Left 1036200243 8:6764975-6764997 CCTGCACCCACTCTCACTGGCTC No data
Right 1036200247 8:6764990-6765012 ACTGGCTCGTGGATAGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036200247 Original CRISPR ACTGGCTCGTGGATAGATTT TGG Intergenic
No off target data available for this crispr