ID: 1036201532

View in Genome Browser
Species Human (GRCh38)
Location 8:6774715-6774737
Sequence GCGTGTGCACCTGTGTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036201532_1036201534 -9 Left 1036201532 8:6774715-6774737 CCTCAGCACACAGGTGCACACGC No data
Right 1036201534 8:6774729-6774751 TGCACACGCTGCCTGGACAATGG No data
1036201532_1036201536 9 Left 1036201532 8:6774715-6774737 CCTCAGCACACAGGTGCACACGC No data
Right 1036201536 8:6774747-6774769 AATGGCCAGAGAACTGCCACAGG No data
1036201532_1036201539 27 Left 1036201532 8:6774715-6774737 CCTCAGCACACAGGTGCACACGC No data
Right 1036201539 8:6774765-6774787 ACAGGTCACACTGTGTCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036201532 Original CRISPR GCGTGTGCACCTGTGTGCTG AGG (reversed) Intergenic
No off target data available for this crispr