ID: 1036202944

View in Genome Browser
Species Human (GRCh38)
Location 8:6784501-6784523
Sequence TTAATGATCGAGACCTTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036202944_1036202958 26 Left 1036202944 8:6784501-6784523 CCCCATAAGGTCTCGATCATTAA No data
Right 1036202958 8:6784550-6784572 GAAACCATGTTAGATGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036202944 Original CRISPR TTAATGATCGAGACCTTATG GGG (reversed) Intergenic
No off target data available for this crispr