ID: 1036202945

View in Genome Browser
Species Human (GRCh38)
Location 8:6784502-6784524
Sequence TTTAATGATCGAGACCTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036202945_1036202958 25 Left 1036202945 8:6784502-6784524 CCCATAAGGTCTCGATCATTAAA No data
Right 1036202958 8:6784550-6784572 GAAACCATGTTAGATGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036202945 Original CRISPR TTTAATGATCGAGACCTTAT GGG (reversed) Intergenic
No off target data available for this crispr