ID: 1036202949

View in Genome Browser
Species Human (GRCh38)
Location 8:6784525-6784547
Sequence GGCTGGCTCAGGGGCCTCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036202949_1036202958 2 Left 1036202949 8:6784525-6784547 CCCCGGAGGCCCCTGAGCCAGCC No data
Right 1036202958 8:6784550-6784572 GAAACCATGTTAGATGCTCCTGG No data
1036202949_1036202962 27 Left 1036202949 8:6784525-6784547 CCCCGGAGGCCCCTGAGCCAGCC No data
Right 1036202962 8:6784575-6784597 CAGTCACTGCCCCCTCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036202949 Original CRISPR GGCTGGCTCAGGGGCCTCCG GGG (reversed) Intergenic
No off target data available for this crispr