ID: 1036202950

View in Genome Browser
Species Human (GRCh38)
Location 8:6784526-6784548
Sequence GGGCTGGCTCAGGGGCCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036202950_1036202962 26 Left 1036202950 8:6784526-6784548 CCCGGAGGCCCCTGAGCCAGCCC No data
Right 1036202962 8:6784575-6784597 CAGTCACTGCCCCCTCTCCCAGG No data
1036202950_1036202958 1 Left 1036202950 8:6784526-6784548 CCCGGAGGCCCCTGAGCCAGCCC No data
Right 1036202958 8:6784550-6784572 GAAACCATGTTAGATGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036202950 Original CRISPR GGGCTGGCTCAGGGGCCTCC GGG (reversed) Intergenic
No off target data available for this crispr