ID: 1036202953

View in Genome Browser
Species Human (GRCh38)
Location 8:6784535-6784557
Sequence ATGGTTTCTGGGCTGGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036202953_1036202962 17 Left 1036202953 8:6784535-6784557 CCCTGAGCCAGCCCAGAAACCAT No data
Right 1036202962 8:6784575-6784597 CAGTCACTGCCCCCTCTCCCAGG No data
1036202953_1036202958 -8 Left 1036202953 8:6784535-6784557 CCCTGAGCCAGCCCAGAAACCAT No data
Right 1036202958 8:6784550-6784572 GAAACCATGTTAGATGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036202953 Original CRISPR ATGGTTTCTGGGCTGGCTCA GGG (reversed) Intergenic
No off target data available for this crispr