ID: 1036202955 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:6784542-6784564 |
| Sequence | ATCTAACATGGTTTCTGGGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1036202955_1036202962 | 10 | Left | 1036202955 | 8:6784542-6784564 | CCAGCCCAGAAACCATGTTAGAT | No data | ||
| Right | 1036202962 | 8:6784575-6784597 | CAGTCACTGCCCCCTCTCCCAGG | No data | ||||
| 1036202955_1036202969 | 28 | Left | 1036202955 | 8:6784542-6784564 | CCAGCCCAGAAACCATGTTAGAT | No data | ||
| Right | 1036202969 | 8:6784593-6784615 | CCAGGACGTGCTCCTCAAACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1036202955 | Original CRISPR | ATCTAACATGGTTTCTGGGC TGG (reversed) | Intergenic | ||