ID: 1036202958

View in Genome Browser
Species Human (GRCh38)
Location 8:6784550-6784572
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036202951_1036202958 0 Left 1036202951 8:6784527-6784549 CCGGAGGCCCCTGAGCCAGCCCA No data
Right 1036202958 8:6784550-6784572 GAAACCATGTTAGATGCTCCTGG No data
1036202950_1036202958 1 Left 1036202950 8:6784526-6784548 CCCGGAGGCCCCTGAGCCAGCCC No data
Right 1036202958 8:6784550-6784572 GAAACCATGTTAGATGCTCCTGG No data
1036202944_1036202958 26 Left 1036202944 8:6784501-6784523 CCCCATAAGGTCTCGATCATTAA No data
Right 1036202958 8:6784550-6784572 GAAACCATGTTAGATGCTCCTGG No data
1036202954_1036202958 -9 Left 1036202954 8:6784536-6784558 CCTGAGCCAGCCCAGAAACCATG No data
Right 1036202958 8:6784550-6784572 GAAACCATGTTAGATGCTCCTGG No data
1036202949_1036202958 2 Left 1036202949 8:6784525-6784547 CCCCGGAGGCCCCTGAGCCAGCC No data
Right 1036202958 8:6784550-6784572 GAAACCATGTTAGATGCTCCTGG No data
1036202952_1036202958 -7 Left 1036202952 8:6784534-6784556 CCCCTGAGCCAGCCCAGAAACCA No data
Right 1036202958 8:6784550-6784572 GAAACCATGTTAGATGCTCCTGG No data
1036202946_1036202958 24 Left 1036202946 8:6784503-6784525 CCATAAGGTCTCGATCATTAAAC No data
Right 1036202958 8:6784550-6784572 GAAACCATGTTAGATGCTCCTGG No data
1036202945_1036202958 25 Left 1036202945 8:6784502-6784524 CCCATAAGGTCTCGATCATTAAA No data
Right 1036202958 8:6784550-6784572 GAAACCATGTTAGATGCTCCTGG No data
1036202953_1036202958 -8 Left 1036202953 8:6784535-6784557 CCCTGAGCCAGCCCAGAAACCAT No data
Right 1036202958 8:6784550-6784572 GAAACCATGTTAGATGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036202958 Original CRISPR GAAACCATGTTAGATGCTCC TGG Intergenic