ID: 1036202959

View in Genome Browser
Species Human (GRCh38)
Location 8:6784554-6784576
Sequence TGGACCAGGAGCATCTAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036202959_1036202962 -2 Left 1036202959 8:6784554-6784576 CCATGTTAGATGCTCCTGGTCCA No data
Right 1036202962 8:6784575-6784597 CAGTCACTGCCCCCTCTCCCAGG No data
1036202959_1036202969 16 Left 1036202959 8:6784554-6784576 CCATGTTAGATGCTCCTGGTCCA No data
Right 1036202969 8:6784593-6784615 CCAGGACGTGCTCCTCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036202959 Original CRISPR TGGACCAGGAGCATCTAACA TGG (reversed) Intergenic