ID: 1036202962

View in Genome Browser
Species Human (GRCh38)
Location 8:6784575-6784597
Sequence CAGTCACTGCCCCCTCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036202955_1036202962 10 Left 1036202955 8:6784542-6784564 CCAGCCCAGAAACCATGTTAGAT No data
Right 1036202962 8:6784575-6784597 CAGTCACTGCCCCCTCTCCCAGG No data
1036202950_1036202962 26 Left 1036202950 8:6784526-6784548 CCCGGAGGCCCCTGAGCCAGCCC No data
Right 1036202962 8:6784575-6784597 CAGTCACTGCCCCCTCTCCCAGG No data
1036202953_1036202962 17 Left 1036202953 8:6784535-6784557 CCCTGAGCCAGCCCAGAAACCAT No data
Right 1036202962 8:6784575-6784597 CAGTCACTGCCCCCTCTCCCAGG No data
1036202952_1036202962 18 Left 1036202952 8:6784534-6784556 CCCCTGAGCCAGCCCAGAAACCA No data
Right 1036202962 8:6784575-6784597 CAGTCACTGCCCCCTCTCCCAGG No data
1036202956_1036202962 6 Left 1036202956 8:6784546-6784568 CCCAGAAACCATGTTAGATGCTC No data
Right 1036202962 8:6784575-6784597 CAGTCACTGCCCCCTCTCCCAGG No data
1036202959_1036202962 -2 Left 1036202959 8:6784554-6784576 CCATGTTAGATGCTCCTGGTCCA No data
Right 1036202962 8:6784575-6784597 CAGTCACTGCCCCCTCTCCCAGG No data
1036202949_1036202962 27 Left 1036202949 8:6784525-6784547 CCCCGGAGGCCCCTGAGCCAGCC No data
Right 1036202962 8:6784575-6784597 CAGTCACTGCCCCCTCTCCCAGG No data
1036202951_1036202962 25 Left 1036202951 8:6784527-6784549 CCGGAGGCCCCTGAGCCAGCCCA No data
Right 1036202962 8:6784575-6784597 CAGTCACTGCCCCCTCTCCCAGG No data
1036202954_1036202962 16 Left 1036202954 8:6784536-6784558 CCTGAGCCAGCCCAGAAACCATG No data
Right 1036202962 8:6784575-6784597 CAGTCACTGCCCCCTCTCCCAGG No data
1036202957_1036202962 5 Left 1036202957 8:6784547-6784569 CCAGAAACCATGTTAGATGCTCC No data
Right 1036202962 8:6784575-6784597 CAGTCACTGCCCCCTCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036202962 Original CRISPR CAGTCACTGCCCCCTCTCCC AGG Intergenic