ID: 1036208361

View in Genome Browser
Species Human (GRCh38)
Location 8:6821943-6821965
Sequence GAGGCTGTTCAACCTGCTCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036208361_1036208366 13 Left 1036208361 8:6821943-6821965 CCACGAGCAGGTTGAACAGCCTC 0: 1
1: 0
2: 0
3: 7
4: 152
Right 1036208366 8:6821979-6822001 TGTCGATGATGTCACTCTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 63
1036208361_1036208367 14 Left 1036208361 8:6821943-6821965 CCACGAGCAGGTTGAACAGCCTC 0: 1
1: 0
2: 0
3: 7
4: 152
Right 1036208367 8:6821980-6822002 GTCGATGATGTCACTCTGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036208361 Original CRISPR GAGGCTGTTCAACCTGCTCG TGG (reversed) Exonic
900330674 1:2133044-2133066 GAGTTTGTTCACCCTGCTGGAGG + Intronic
900379254 1:2375713-2375735 GAGGCTGGGCAGCCAGCTCGGGG + Intronic
905856192 1:41316292-41316314 GAGGCTGCTGAACCAGCTCGGGG - Intergenic
907108872 1:51908529-51908551 TCTGCTGTTCAACCTGCTCCAGG + Exonic
922543414 1:226435828-226435850 GAGGCTAAACAACCTGCTGGAGG + Intergenic
923140909 1:231161346-231161368 GAGGCTGTTCCCGCAGCTCGTGG + Intergenic
1065730852 10:28708300-28708322 GAGGCTGAGCAACCTGCTCAAGG - Intergenic
1070920909 10:80185735-80185757 GAGGCTGTGTAACTTGCTCAAGG + Intronic
1072254999 10:93612980-93613002 GAGGCTGGCCCACCTGCTCCAGG + Exonic
1075091469 10:119446278-119446300 GCGGGTGTTCAACCTGCACACGG + Intronic
1076564580 10:131389390-131389412 GAGGCTGGGCCACCTGCTCACGG + Intergenic
1077582884 11:3428301-3428323 GAGGCTGTTCTGGCTGCTCCTGG + Intergenic
1078398644 11:11003553-11003575 GATGCTGTTTAACCTGATAGTGG + Intergenic
1086534584 11:87829514-87829536 GAGGCAGTTCTCCCTGCTCTTGG - Intergenic
1089676881 11:120096240-120096262 GAGGCTGTTTAACTTGCCCAAGG - Intergenic
1092505405 12:9093526-9093548 GAGGCTCTTCAACATGCACCAGG + Exonic
1099468880 12:83022003-83022025 GAGGCTGTTCAACCCTTTCTTGG + Intronic
1105265092 13:18808611-18808633 GTGGCTGGTCCACCTGCTCCTGG + Intergenic
1110141660 13:72138156-72138178 GAGGCTGTTCAAACTGTCCTGGG + Intergenic
1114061052 14:19016071-19016093 GTGGCTGCTCCACCTGCTCTAGG - Intergenic
1114061161 14:19016710-19016732 GTGGCTGCTCCACCTGCTCCAGG - Intergenic
1114101093 14:19383269-19383291 GTGGCTGCTCCACCTGCTCCAGG + Intergenic
1114101204 14:19383908-19383930 GTGGCTGCTCCACCTGCTCTAGG + Intergenic
1117762391 14:59043768-59043790 GTGTCTGTTCATCCTGCTTGTGG + Intergenic
1123105579 14:105839690-105839712 GAGGCTGTCCGCCCTGCTCAGGG - Intergenic
1202906497 14_GL000194v1_random:76613-76635 GTGGCTGTTCCACCTGCTCCAGG - Intergenic
1123496136 15:20828674-20828696 GTGGCTGGTCCACCTGCTCCAGG - Intergenic
1123552619 15:21397768-21397790 GTGGCTGGTCTACCTGCTCCTGG - Intergenic
1123552652 15:21397960-21397982 GTGGCTGCTCTACCTGCTCCCGG + Intergenic
1123552866 15:21399241-21399263 GTGGCTGCTCCACCTGCTCCAGG + Intergenic
1123552978 15:21399880-21399902 GTGGCTGCTCCACCTGCTCCTGG + Intergenic
1123553047 15:21400333-21400355 GTGGCTGGTCCACCTGCTCCTGG - Intergenic
1123553082 15:21400521-21400543 GTGGCTGCTCCACCTGCTCCAGG + Intergenic
1123553257 15:21401602-21401624 GTGGCTGGTCCACCTGCTCCTGG - Intergenic
1123553370 15:21402240-21402262 GTGGCTGGTCCACCTGCTCCAGG - Intergenic
1123588865 15:21835156-21835178 GTGGCTGGTCTACCTGCTCCTGG - Intergenic
1123588899 15:21835348-21835370 GTGGCTGCTCTACCTGCTCCCGG + Intergenic
1123589112 15:21836629-21836651 GTGGCTGCTCCACCTGCTCCAGG + Intergenic
1123589224 15:21837268-21837290 GTGGCTGCTCCACCTGCTCCTGG + Intergenic
1123589292 15:21837721-21837743 GTGGCTGGTCCACCTGCTCCTGG - Intergenic
1123589327 15:21837909-21837931 GTGGCTGCTCCACCTGCTCCAGG + Intergenic
1123589502 15:21838990-21839012 GTGGCTGGTCCACCTGCTCCTGG - Intergenic
1123589615 15:21839628-21839650 GTGGCTGGTCCACCTGCTCCAGG - Intergenic
1125614062 15:40994092-40994114 GATTCTGTTCTACCTGCTCTGGG + Intronic
1125675031 15:41497301-41497323 GAGGATGTTCAAGCTTCTCCCGG + Intronic
1128598197 15:68972968-68972990 GAGGCTGAGCCACCTGCTCATGG + Intronic
1202960968 15_KI270727v1_random:124988-125010 GTGGCTGGTCTACCTGCTCCTGG - Intergenic
1202961002 15_KI270727v1_random:125180-125202 GTGGCTGCTCTACCTGCTCCCGG + Intergenic
1202961215 15_KI270727v1_random:126461-126483 GTGGCTGCTCCACCTGCTCCAGG + Intergenic
1202961327 15_KI270727v1_random:127100-127122 GTGGCTGCTCCACCTGCTCCTGG + Intergenic
1202961395 15_KI270727v1_random:127553-127575 GTGGCTGGTCCACCTGCTCCTGG - Intergenic
1202961430 15_KI270727v1_random:127741-127763 GTGGCTGCTCCACCTGCTCCAGG + Intergenic
1202961718 15_KI270727v1_random:129460-129482 GTGGCTGGTCCACCTGCTCCAGG - Intergenic
1135129033 16:19836907-19836929 GAGGTTAAGCAACCTGCTCGAGG - Intronic
1139384067 16:66552818-66552840 GAGGCTGATGAAGCTGCTGGGGG + Intronic
1141664948 16:85461217-85461239 GAGGCTGTTCTGTCTGCTGGAGG + Intergenic
1141753988 16:85979134-85979156 GAGGCTGCTCAGCCTGCCCAGGG - Intergenic
1142682494 17:1558591-1558613 TAGGCTGTGCAATCTGCTCAAGG + Intronic
1144486470 17:15669720-15669742 GAGGCTGTACCACCACCTCGTGG + Intronic
1144779755 17:17801837-17801859 GAGGCTGAGTAACCTGCCCGAGG - Intronic
1151434826 17:74088684-74088706 GAGGCAGCTCAATCTGCTCAGGG - Intergenic
1153746519 18:8185401-8185423 GAAGCTGATCACCTTGCTCGGGG + Intronic
1154453566 18:14501357-14501379 GTGGCTGCTCCACCTGCTCCCGG + Intergenic
1154453739 18:14502450-14502472 GTGGCTGGTCCACCTGCTCCTGG - Intergenic
1154453774 18:14502638-14502660 GTGGCTGCTCCACCTGCTCCAGG + Intergenic
1154454055 18:14504357-14504379 GTGGCTGGTCCACCTGCTCCAGG - Intergenic
1155495330 18:26436786-26436808 ACGGCTGTTCAGCCTGCTCTGGG - Intergenic
1167109060 19:47448110-47448132 GCGGCTGCTGAACCTGCGCGTGG - Exonic
1168105670 19:54164499-54164521 GGTGCTGCTCAACCTGCTGGTGG - Exonic
1202649681 1_KI270706v1_random:169232-169254 GTGGCTGGTCCACCTGCTCCAGG - Intergenic
1202649741 1_KI270706v1_random:169597-169619 GCGGCTGGTCCACCTGCTCCTGG + Intergenic
925586682 2:5471591-5471613 GAGGTTGGTCATCCTTCTCGAGG - Intergenic
934494709 2:94787461-94787483 GTGGCTGGTCCACCTGCTCCTGG - Intergenic
934494748 2:94787649-94787671 GTGGCTGGTCCACCTGCTCTTGG + Intergenic
935489478 2:103698766-103698788 GGGGCTGTTCTACCTGCCAGGGG - Intergenic
935545472 2:104395713-104395735 GAGGCTGTGAAACTTGCTCTTGG + Intergenic
935828701 2:106976988-106977010 GAGGCTGTTTTTCCTGCTCCTGG + Intergenic
938280694 2:130061732-130061754 GTGGCTGGTCCACCTGCTCCTGG + Intergenic
938280801 2:130062363-130062385 GTGGCTGGTCCACCTGCTCCTGG + Intergenic
938331445 2:130451200-130451222 GTGGCTGGTCCACCTGCTCCTGG + Intergenic
938331849 2:130453649-130453671 GTGGCTGGTCCACCTGCTCCTGG + Intergenic
938434899 2:131276969-131276991 GTGGCTGGTCCACCTGCTCCTGG - Intronic
938477893 2:131633194-131633216 GTGGCTGGTCCACCTGCTCCAGG + Intergenic
938478429 2:131636435-131636457 GTGGCTGCTCCACCTGCTCTAGG - Intergenic
938478535 2:131637070-131637092 GTGGCTGCTCCACCTGCTCCTGG - Intergenic
948739417 2:240033193-240033215 GAGGCTGTTGAGCCCGCTCCTGG + Intergenic
1171881553 20:30621218-30621240 GTGGCTGCTCCACCTGCTCCAGG + Intergenic
1173899250 20:46575229-46575251 GACACTGTTCAACATGCTTGTGG - Intronic
1174691391 20:52510152-52510174 GAGGCAGCTCAACCTGCACGTGG + Intergenic
1176602081 21:8802950-8802972 GCGGCTGGTCCACCTGCTCCTGG - Intergenic
1176602142 21:8803315-8803337 GTGGCTGGTCCACCTGCTCCAGG + Intergenic
1176625844 21:9091412-9091434 GTGGCTGGTCCACCTGCTCCAGG - Intergenic
1176625907 21:9091777-9091799 GCGGCTGGTCAATCTGCTCCTGG + Intergenic
1176820119 21:13648939-13648961 GAGGCTGGTCCACCTGCTCCAGG + Intergenic
1176820227 21:13649577-13649599 GTGGCTGGTCCACCTGCTCCTGG + Intergenic
1176820406 21:13650667-13650689 GTGGCTGCTCCACCTGCTCCAGG - Intergenic
1176820442 21:13650855-13650877 GTGGCTGGTCCACCTGCTCCTGG + Intergenic
1176820615 21:13651948-13651970 GTGGCTGCTCCACCTGCTCCCGG - Intergenic
1176850172 21:13907076-13907098 GTGGCTGGTCCACCTGCTCCTGG + Intergenic
1178669031 21:34574503-34574525 GAGGCTGATCTACCTTCTGGGGG - Intronic
1180344427 22:11694866-11694888 GTGGCTGGTCCACCTGCTCCAGG + Intergenic
1180479535 22:15738683-15738705 GTGGCTGCTCCACCTGCTCTAGG - Intergenic
1181311327 22:21946440-21946462 GAGGGGGTTCAACCTGATCACGG + Intronic
1181957993 22:26602116-26602138 GAGCCTGTTCAGGCTGCTGGGGG + Intronic
1184019084 22:41808554-41808576 AAGGCTGGGCAAGCTGCTCGAGG + Intronic
949487736 3:4556218-4556240 GAGGCTGTGCACCCTGATGGGGG - Intronic
952234971 3:31469940-31469962 GGGGCTGTTCTTCCTGCTTGAGG - Intergenic
952501947 3:33971198-33971220 GAGGGTCTTCAACCTGCGCCAGG - Intergenic
954803312 3:53200102-53200124 GAGGCTGAACAGCCTGCTCAGGG - Intergenic
961177592 3:124848588-124848610 GAGGTTGTGCAACCTGCTGAGGG + Intronic
967309972 3:188096487-188096509 GAGGCTGAACAACTGGCTCGAGG - Intergenic
973365403 4:49204757-49204779 GCGGCTGGTCCACCTGCTCCTGG - Intergenic
973365466 4:49205122-49205144 GTGGCTGGTCCACCTGCTCCAGG + Intergenic
973395127 4:49587332-49587354 GTGGCTGGTCCACCTGCTCCAGG - Intergenic
975616963 4:76256370-76256392 GAGGCAGATCAAGCTGCTCAAGG + Exonic
981739412 4:147986292-147986314 GAGGGTCATCAACTTGCTCGAGG + Intronic
985123134 4:186663732-186663754 AAGGCTGGTTAACCTGCTCAAGG - Intronic
986128891 5:4909197-4909219 GAGGCTGTTCATCCTACTTCAGG + Intergenic
998523119 5:142818310-142818332 GAGGCTGTGCCACCTGACCGGGG - Intronic
999984206 5:156987287-156987309 GAGACTGAACAACCTGCTCCTGG + Intergenic
1007494952 6:42253403-42253425 GAGGCTGTCCAGCCTCCTGGAGG - Intronic
1008235913 6:49049668-49049690 GAGGCTGAGTAACCTGCTAGTGG + Intergenic
1015446176 6:133307799-133307821 AAGGCTGTAGAACCTGCTGGAGG + Intronic
1019713127 7:2526400-2526422 GAGGATGGTGCACCTGCTCGTGG - Exonic
1021406509 7:20273938-20273960 GAAGCTCTTCAACCTACTAGGGG + Intergenic
1022030225 7:26486040-26486062 GAGGCTCTTCATCCTGGTGGAGG - Intergenic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1023866895 7:44242628-44242650 GATCCTGTACATCCTGCTCGTGG - Exonic
1024281774 7:47724581-47724603 CAGGCTGTTCCACCTGCTTCAGG - Intronic
1028705440 7:93839536-93839558 GAGGGTGTTCTACTAGCTCGTGG - Intronic
1028735091 7:94200590-94200612 GAGAATGTTCCACCTGCACGTGG + Intergenic
1030074345 7:105723601-105723623 GAGGCTGCCCACCCTGCTCCTGG + Intronic
1036208361 8:6821943-6821965 GAGGCTGTTCAACCTGCTCGTGG - Exonic
1040101915 8:43513228-43513250 GTGGCTGGTCCACCTGCTCCTGG - Intergenic
1042987988 8:74604543-74604565 GCGGCTGCTCAAGCTGCTCTGGG + Intronic
1048144589 8:131828640-131828662 GAGGGTGTACAACCTGCTATAGG - Intergenic
1052128446 9:24809261-24809283 AGAGCTGTTCAACCTGCTCCAGG - Intergenic
1052877224 9:33575987-33576009 GTGGCTGGTCCACCTGCTCCTGG + Intergenic
1053498778 9:38568407-38568429 GTGGCTGGTCCACCTGCTCCTGG - Intronic
1053662370 9:40292710-40292732 GTGGCTGGTCCACCTGCTCCTGG - Intronic
1053662412 9:40292898-40292920 GTGGCTGGTCCACCTGCTCCTGG + Intronic
1053912823 9:42922875-42922897 GTGGCTGGTCCACCTGCTCCTGG - Intergenic
1053912862 9:42923053-42923075 GTGGCTGGTCCACCTGCTCCTGG + Intergenic
1054374499 9:64438939-64438961 GTGGCTGGTCCACCTGCTCCTGG - Intergenic
1054374543 9:64439127-64439149 GTGGCTGGTCCACCTGCTCCTGG + Intergenic
1054522198 9:66083386-66083408 GTGGCTGGTCCACCTGCTCCTGG - Intergenic
1054522240 9:66083574-66083596 GTGGCTGGTCCACCTGCTCCTGG + Intergenic
1057161833 9:92894705-92894727 GTGGCTGGTCCACCTGCTCCTGG - Intergenic
1057161872 9:92894893-92894915 GTGGCTGGTCCACCTGCTCCAGG + Intergenic
1203526809 Un_GL000213v1:98066-98088 GTGGCTGGTCCACCTGCTCCTGG - Intergenic
1203526844 Un_GL000213v1:98254-98276 GTGGCTGCTCCACCTGCTCCAGG + Intergenic
1203526927 Un_GL000213v1:98705-98727 GTGGCTGGTCCACCTGCTCCTGG - Intergenic
1203526964 Un_GL000213v1:98893-98915 GTGGCTGCTCCACCTGCTCCAGG + Intergenic
1203527133 Un_GL000213v1:99974-99996 GTGGCTGGTCCACCTGCTCCTGG - Intergenic
1203527241 Un_GL000213v1:100612-100634 GAGGCTGGTCCACCTGCTCCAGG - Intergenic
1203749017 Un_GL000218v1:61833-61855 GTGGCTGGTCCACCTGCTCCAGG - Intergenic
1187312734 X:18161289-18161311 GTGGCTGTTAACCATGCTCGGGG + Intergenic
1188048132 X:25451518-25451540 GAGGCTCTTCATACTGCTAGAGG + Intergenic
1189491550 X:41474679-41474701 GAGGCTGCTGAACCTGCTCACGG - Exonic
1201162374 Y:11176847-11176869 GTGGCTGGTCTACCTGCTCCAGG - Intergenic