ID: 1036209257

View in Genome Browser
Species Human (GRCh38)
Location 8:6828735-6828757
Sequence CCCTGGTGCCATCTGTCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036209253_1036209257 1 Left 1036209253 8:6828711-6828733 CCCAACTCTGTTGCATTTTATTG 0: 1
1: 0
2: 2
3: 30
4: 314
Right 1036209257 8:6828735-6828757 CCCTGGTGCCATCTGTCTACAGG No data
1036209254_1036209257 0 Left 1036209254 8:6828712-6828734 CCAACTCTGTTGCATTTTATTGT 0: 1
1: 0
2: 1
3: 59
4: 655
Right 1036209257 8:6828735-6828757 CCCTGGTGCCATCTGTCTACAGG No data
1036209249_1036209257 10 Left 1036209249 8:6828702-6828724 CCCGTCCCTCCCAACTCTGTTGC 0: 1
1: 0
2: 0
3: 26
4: 281
Right 1036209257 8:6828735-6828757 CCCTGGTGCCATCTGTCTACAGG No data
1036209251_1036209257 5 Left 1036209251 8:6828707-6828729 CCCTCCCAACTCTGTTGCATTTT 0: 1
1: 1
2: 8
3: 36
4: 339
Right 1036209257 8:6828735-6828757 CCCTGGTGCCATCTGTCTACAGG No data
1036209250_1036209257 9 Left 1036209250 8:6828703-6828725 CCGTCCCTCCCAACTCTGTTGCA 0: 1
1: 0
2: 23
3: 195
4: 703
Right 1036209257 8:6828735-6828757 CCCTGGTGCCATCTGTCTACAGG No data
1036209247_1036209257 21 Left 1036209247 8:6828691-6828713 CCTGCATGGACCCCGTCCCTCCC 0: 1
1: 0
2: 0
3: 25
4: 270
Right 1036209257 8:6828735-6828757 CCCTGGTGCCATCTGTCTACAGG No data
1036209252_1036209257 4 Left 1036209252 8:6828708-6828730 CCTCCCAACTCTGTTGCATTTTA 0: 1
1: 0
2: 5
3: 48
4: 520
Right 1036209257 8:6828735-6828757 CCCTGGTGCCATCTGTCTACAGG No data
1036209248_1036209257 11 Left 1036209248 8:6828701-6828723 CCCCGTCCCTCCCAACTCTGTTG 0: 1
1: 0
2: 1
3: 17
4: 366
Right 1036209257 8:6828735-6828757 CCCTGGTGCCATCTGTCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036209257 Original CRISPR CCCTGGTGCCATCTGTCTAC AGG Intronic
No off target data available for this crispr