ID: 1036209544

View in Genome Browser
Species Human (GRCh38)
Location 8:6831250-6831272
Sequence GCAGAGAAGGATCTTTCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036209544_1036209556 16 Left 1036209544 8:6831250-6831272 CCCTCCGAAAGATCCTTCTCTGC No data
Right 1036209556 8:6831289-6831311 GGAAGGGCCCTGTCTTTTCAGGG No data
1036209544_1036209558 22 Left 1036209544 8:6831250-6831272 CCCTCCGAAAGATCCTTCTCTGC No data
Right 1036209558 8:6831295-6831317 GCCCTGTCTTTTCAGGGGAACGG No data
1036209544_1036209551 -1 Left 1036209544 8:6831250-6831272 CCCTCCGAAAGATCCTTCTCTGC No data
Right 1036209551 8:6831272-6831294 CCTTCTCCGCCATGGAAGGAAGG No data
1036209544_1036209548 -9 Left 1036209544 8:6831250-6831272 CCCTCCGAAAGATCCTTCTCTGC No data
Right 1036209548 8:6831264-6831286 CTTCTCTGCCTTCTCCGCCATGG No data
1036209544_1036209555 15 Left 1036209544 8:6831250-6831272 CCCTCCGAAAGATCCTTCTCTGC No data
Right 1036209555 8:6831288-6831310 AGGAAGGGCCCTGTCTTTTCAGG No data
1036209544_1036209549 -5 Left 1036209544 8:6831250-6831272 CCCTCCGAAAGATCCTTCTCTGC No data
Right 1036209549 8:6831268-6831290 TCTGCCTTCTCCGCCATGGAAGG No data
1036209544_1036209557 17 Left 1036209544 8:6831250-6831272 CCCTCCGAAAGATCCTTCTCTGC No data
Right 1036209557 8:6831290-6831312 GAAGGGCCCTGTCTTTTCAGGGG No data
1036209544_1036209552 0 Left 1036209544 8:6831250-6831272 CCCTCCGAAAGATCCTTCTCTGC No data
Right 1036209552 8:6831273-6831295 CTTCTCCGCCATGGAAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036209544 Original CRISPR GCAGAGAAGGATCTTTCGGA GGG (reversed) Intronic