ID: 1036209545

View in Genome Browser
Species Human (GRCh38)
Location 8:6831251-6831273
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036209545_1036209557 16 Left 1036209545 8:6831251-6831273 CCTCCGAAAGATCCTTCTCTGCC No data
Right 1036209557 8:6831290-6831312 GAAGGGCCCTGTCTTTTCAGGGG 0: 1
1: 0
2: 3
3: 18
4: 173
1036209545_1036209548 -10 Left 1036209545 8:6831251-6831273 CCTCCGAAAGATCCTTCTCTGCC No data
Right 1036209548 8:6831264-6831286 CTTCTCTGCCTTCTCCGCCATGG No data
1036209545_1036209552 -1 Left 1036209545 8:6831251-6831273 CCTCCGAAAGATCCTTCTCTGCC No data
Right 1036209552 8:6831273-6831295 CTTCTCCGCCATGGAAGGAAGGG No data
1036209545_1036209558 21 Left 1036209545 8:6831251-6831273 CCTCCGAAAGATCCTTCTCTGCC No data
Right 1036209558 8:6831295-6831317 GCCCTGTCTTTTCAGGGGAACGG No data
1036209545_1036209549 -6 Left 1036209545 8:6831251-6831273 CCTCCGAAAGATCCTTCTCTGCC No data
Right 1036209549 8:6831268-6831290 TCTGCCTTCTCCGCCATGGAAGG No data
1036209545_1036209555 14 Left 1036209545 8:6831251-6831273 CCTCCGAAAGATCCTTCTCTGCC No data
Right 1036209555 8:6831288-6831310 AGGAAGGGCCCTGTCTTTTCAGG No data
1036209545_1036209556 15 Left 1036209545 8:6831251-6831273 CCTCCGAAAGATCCTTCTCTGCC No data
Right 1036209556 8:6831289-6831311 GGAAGGGCCCTGTCTTTTCAGGG 0: 1
1: 0
2: 3
3: 14
4: 175
1036209545_1036209551 -2 Left 1036209545 8:6831251-6831273 CCTCCGAAAGATCCTTCTCTGCC No data
Right 1036209551 8:6831272-6831294 CCTTCTCCGCCATGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036209545 Original CRISPR GGCAGAGAAGGATCTTTCGG AGG (reversed) Intronic