ID: 1036209548

View in Genome Browser
Species Human (GRCh38)
Location 8:6831264-6831286
Sequence CTTCTCTGCCTTCTCCGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036209543_1036209548 0 Left 1036209543 8:6831241-6831263 CCTATGAGGCCCTCCGAAAGATC No data
Right 1036209548 8:6831264-6831286 CTTCTCTGCCTTCTCCGCCATGG No data
1036209544_1036209548 -9 Left 1036209544 8:6831250-6831272 CCCTCCGAAAGATCCTTCTCTGC No data
Right 1036209548 8:6831264-6831286 CTTCTCTGCCTTCTCCGCCATGG No data
1036209545_1036209548 -10 Left 1036209545 8:6831251-6831273 CCTCCGAAAGATCCTTCTCTGCC No data
Right 1036209548 8:6831264-6831286 CTTCTCTGCCTTCTCCGCCATGG No data
1036209542_1036209548 1 Left 1036209542 8:6831240-6831262 CCCTATGAGGCCCTCCGAAAGAT No data
Right 1036209548 8:6831264-6831286 CTTCTCTGCCTTCTCCGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036209548 Original CRISPR CTTCTCTGCCTTCTCCGCCA TGG Intronic