ID: 1036209550

View in Genome Browser
Species Human (GRCh38)
Location 8:6831272-6831294
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036209550_1036209557 -5 Left 1036209550 8:6831272-6831294 CCTTCTCCGCCATGGAAGGAAGG No data
Right 1036209557 8:6831290-6831312 GAAGGGCCCTGTCTTTTCAGGGG No data
1036209550_1036209556 -6 Left 1036209550 8:6831272-6831294 CCTTCTCCGCCATGGAAGGAAGG No data
Right 1036209556 8:6831289-6831311 GGAAGGGCCCTGTCTTTTCAGGG No data
1036209550_1036209561 19 Left 1036209550 8:6831272-6831294 CCTTCTCCGCCATGGAAGGAAGG No data
Right 1036209561 8:6831314-6831336 ACGGCACTGCTTGAACACCAAGG No data
1036209550_1036209558 0 Left 1036209550 8:6831272-6831294 CCTTCTCCGCCATGGAAGGAAGG No data
Right 1036209558 8:6831295-6831317 GCCCTGTCTTTTCAGGGGAACGG No data
1036209550_1036209555 -7 Left 1036209550 8:6831272-6831294 CCTTCTCCGCCATGGAAGGAAGG No data
Right 1036209555 8:6831288-6831310 AGGAAGGGCCCTGTCTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036209550 Original CRISPR CCTTCCTTCCATGGCGGAGA AGG (reversed) Intronic