ID: 1036209553

View in Genome Browser
Species Human (GRCh38)
Location 8:6831278-6831300
Sequence CAGGGCCCTTCCTTCCATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036209553_1036209561 13 Left 1036209553 8:6831278-6831300 CCGCCATGGAAGGAAGGGCCCTG No data
Right 1036209561 8:6831314-6831336 ACGGCACTGCTTGAACACCAAGG No data
1036209553_1036209558 -6 Left 1036209553 8:6831278-6831300 CCGCCATGGAAGGAAGGGCCCTG No data
Right 1036209558 8:6831295-6831317 GCCCTGTCTTTTCAGGGGAACGG No data
1036209553_1036209562 25 Left 1036209553 8:6831278-6831300 CCGCCATGGAAGGAAGGGCCCTG No data
Right 1036209562 8:6831326-6831348 GAACACCAAGGCCGAGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036209553 Original CRISPR CAGGGCCCTTCCTTCCATGG CGG (reversed) Intronic