ID: 1036209554

View in Genome Browser
Species Human (GRCh38)
Location 8:6831281-6831303
Sequence AGACAGGGCCCTTCCTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036209554_1036209561 10 Left 1036209554 8:6831281-6831303 CCATGGAAGGAAGGGCCCTGTCT No data
Right 1036209561 8:6831314-6831336 ACGGCACTGCTTGAACACCAAGG No data
1036209554_1036209562 22 Left 1036209554 8:6831281-6831303 CCATGGAAGGAAGGGCCCTGTCT No data
Right 1036209562 8:6831326-6831348 GAACACCAAGGCCGAGCTTTTGG No data
1036209554_1036209558 -9 Left 1036209554 8:6831281-6831303 CCATGGAAGGAAGGGCCCTGTCT No data
Right 1036209558 8:6831295-6831317 GCCCTGTCTTTTCAGGGGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036209554 Original CRISPR AGACAGGGCCCTTCCTTCCA TGG (reversed) Intronic