ID: 1036209555

View in Genome Browser
Species Human (GRCh38)
Location 8:6831288-6831310
Sequence AGGAAGGGCCCTGTCTTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036209546_1036209555 11 Left 1036209546 8:6831254-6831276 CCGAAAGATCCTTCTCTGCCTTC No data
Right 1036209555 8:6831288-6831310 AGGAAGGGCCCTGTCTTTTCAGG No data
1036209547_1036209555 2 Left 1036209547 8:6831263-6831285 CCTTCTCTGCCTTCTCCGCCATG No data
Right 1036209555 8:6831288-6831310 AGGAAGGGCCCTGTCTTTTCAGG No data
1036209545_1036209555 14 Left 1036209545 8:6831251-6831273 CCTCCGAAAGATCCTTCTCTGCC No data
Right 1036209555 8:6831288-6831310 AGGAAGGGCCCTGTCTTTTCAGG No data
1036209543_1036209555 24 Left 1036209543 8:6831241-6831263 CCTATGAGGCCCTCCGAAAGATC No data
Right 1036209555 8:6831288-6831310 AGGAAGGGCCCTGTCTTTTCAGG No data
1036209550_1036209555 -7 Left 1036209550 8:6831272-6831294 CCTTCTCCGCCATGGAAGGAAGG No data
Right 1036209555 8:6831288-6831310 AGGAAGGGCCCTGTCTTTTCAGG No data
1036209544_1036209555 15 Left 1036209544 8:6831250-6831272 CCCTCCGAAAGATCCTTCTCTGC No data
Right 1036209555 8:6831288-6831310 AGGAAGGGCCCTGTCTTTTCAGG No data
1036209542_1036209555 25 Left 1036209542 8:6831240-6831262 CCCTATGAGGCCCTCCGAAAGAT No data
Right 1036209555 8:6831288-6831310 AGGAAGGGCCCTGTCTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036209555 Original CRISPR AGGAAGGGCCCTGTCTTTTC AGG Intronic