ID: 1036209558

View in Genome Browser
Species Human (GRCh38)
Location 8:6831295-6831317
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036209554_1036209558 -9 Left 1036209554 8:6831281-6831303 CCATGGAAGGAAGGGCCCTGTCT No data
Right 1036209558 8:6831295-6831317 GCCCTGTCTTTTCAGGGGAACGG No data
1036209545_1036209558 21 Left 1036209545 8:6831251-6831273 CCTCCGAAAGATCCTTCTCTGCC No data
Right 1036209558 8:6831295-6831317 GCCCTGTCTTTTCAGGGGAACGG No data
1036209550_1036209558 0 Left 1036209550 8:6831272-6831294 CCTTCTCCGCCATGGAAGGAAGG No data
Right 1036209558 8:6831295-6831317 GCCCTGTCTTTTCAGGGGAACGG No data
1036209544_1036209558 22 Left 1036209544 8:6831250-6831272 CCCTCCGAAAGATCCTTCTCTGC No data
Right 1036209558 8:6831295-6831317 GCCCTGTCTTTTCAGGGGAACGG No data
1036209547_1036209558 9 Left 1036209547 8:6831263-6831285 CCTTCTCTGCCTTCTCCGCCATG No data
Right 1036209558 8:6831295-6831317 GCCCTGTCTTTTCAGGGGAACGG No data
1036209553_1036209558 -6 Left 1036209553 8:6831278-6831300 CCGCCATGGAAGGAAGGGCCCTG No data
Right 1036209558 8:6831295-6831317 GCCCTGTCTTTTCAGGGGAACGG No data
1036209546_1036209558 18 Left 1036209546 8:6831254-6831276 CCGAAAGATCCTTCTCTGCCTTC No data
Right 1036209558 8:6831295-6831317 GCCCTGTCTTTTCAGGGGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type