ID: 1036209560

View in Genome Browser
Species Human (GRCh38)
Location 8:6831297-6831319
Sequence TGCCGTTCCCCTGAAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036209560_1036209562 6 Left 1036209560 8:6831297-6831319 CCTGTCTTTTCAGGGGAACGGCA No data
Right 1036209562 8:6831326-6831348 GAACACCAAGGCCGAGCTTTTGG No data
1036209560_1036209565 20 Left 1036209560 8:6831297-6831319 CCTGTCTTTTCAGGGGAACGGCA No data
Right 1036209565 8:6831340-6831362 AGCTTTTGGCAAAATGCCTGTGG No data
1036209560_1036209561 -6 Left 1036209560 8:6831297-6831319 CCTGTCTTTTCAGGGGAACGGCA No data
Right 1036209561 8:6831314-6831336 ACGGCACTGCTTGAACACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036209560 Original CRISPR TGCCGTTCCCCTGAAAAGAC AGG (reversed) Intronic