ID: 1036209561

View in Genome Browser
Species Human (GRCh38)
Location 8:6831314-6831336
Sequence ACGGCACTGCTTGAACACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036209554_1036209561 10 Left 1036209554 8:6831281-6831303 CCATGGAAGGAAGGGCCCTGTCT No data
Right 1036209561 8:6831314-6831336 ACGGCACTGCTTGAACACCAAGG No data
1036209560_1036209561 -6 Left 1036209560 8:6831297-6831319 CCTGTCTTTTCAGGGGAACGGCA No data
Right 1036209561 8:6831314-6831336 ACGGCACTGCTTGAACACCAAGG No data
1036209550_1036209561 19 Left 1036209550 8:6831272-6831294 CCTTCTCCGCCATGGAAGGAAGG No data
Right 1036209561 8:6831314-6831336 ACGGCACTGCTTGAACACCAAGG No data
1036209559_1036209561 -5 Left 1036209559 8:6831296-6831318 CCCTGTCTTTTCAGGGGAACGGC No data
Right 1036209561 8:6831314-6831336 ACGGCACTGCTTGAACACCAAGG No data
1036209547_1036209561 28 Left 1036209547 8:6831263-6831285 CCTTCTCTGCCTTCTCCGCCATG No data
Right 1036209561 8:6831314-6831336 ACGGCACTGCTTGAACACCAAGG No data
1036209553_1036209561 13 Left 1036209553 8:6831278-6831300 CCGCCATGGAAGGAAGGGCCCTG No data
Right 1036209561 8:6831314-6831336 ACGGCACTGCTTGAACACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036209561 Original CRISPR ACGGCACTGCTTGAACACCA AGG Intronic