ID: 1036209562

View in Genome Browser
Species Human (GRCh38)
Location 8:6831326-6831348
Sequence GAACACCAAGGCCGAGCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036209554_1036209562 22 Left 1036209554 8:6831281-6831303 CCATGGAAGGAAGGGCCCTGTCT No data
Right 1036209562 8:6831326-6831348 GAACACCAAGGCCGAGCTTTTGG No data
1036209560_1036209562 6 Left 1036209560 8:6831297-6831319 CCTGTCTTTTCAGGGGAACGGCA No data
Right 1036209562 8:6831326-6831348 GAACACCAAGGCCGAGCTTTTGG No data
1036209553_1036209562 25 Left 1036209553 8:6831278-6831300 CCGCCATGGAAGGAAGGGCCCTG No data
Right 1036209562 8:6831326-6831348 GAACACCAAGGCCGAGCTTTTGG No data
1036209559_1036209562 7 Left 1036209559 8:6831296-6831318 CCCTGTCTTTTCAGGGGAACGGC No data
Right 1036209562 8:6831326-6831348 GAACACCAAGGCCGAGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036209562 Original CRISPR GAACACCAAGGCCGAGCTTT TGG Intronic