ID: 1036210144

View in Genome Browser
Species Human (GRCh38)
Location 8:6834840-6834862
Sequence TGCGACGGAGGTGGCCTCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036210136_1036210144 5 Left 1036210136 8:6834812-6834834 CCGCGGCTGGCGGGCTCTGGGTT No data
Right 1036210144 8:6834840-6834862 TGCGACGGAGGTGGCCTCGAAGG No data
1036210129_1036210144 18 Left 1036210129 8:6834799-6834821 CCATCTTGCTCCGCCGCGGCTGG No data
Right 1036210144 8:6834840-6834862 TGCGACGGAGGTGGCCTCGAAGG No data
1036210133_1036210144 8 Left 1036210133 8:6834809-6834831 CCGCCGCGGCTGGCGGGCTCTGG No data
Right 1036210144 8:6834840-6834862 TGCGACGGAGGTGGCCTCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036210144 Original CRISPR TGCGACGGAGGTGGCCTCGA AGG Intronic