ID: 1036212628

View in Genome Browser
Species Human (GRCh38)
Location 8:6854582-6854604
Sequence CCATGGGAGCTGAGGGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036212628_1036212636 -6 Left 1036212628 8:6854582-6854604 CCTTCAGCCCTCAGCTCCCATGG No data
Right 1036212636 8:6854599-6854621 CCATGGGGAGAGCGTGTCATAGG No data
1036212628_1036212640 29 Left 1036212628 8:6854582-6854604 CCTTCAGCCCTCAGCTCCCATGG No data
Right 1036212640 8:6854634-6854656 ACTGAGCATTTGTCCCCGACAGG No data
1036212628_1036212641 30 Left 1036212628 8:6854582-6854604 CCTTCAGCCCTCAGCTCCCATGG No data
Right 1036212641 8:6854635-6854657 CTGAGCATTTGTCCCCGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036212628 Original CRISPR CCATGGGAGCTGAGGGCTGA AGG (reversed) Intergenic
No off target data available for this crispr