ID: 1036212730

View in Genome Browser
Species Human (GRCh38)
Location 8:6855251-6855273
Sequence GTGACCTCCAGAACAATGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036212730_1036212732 -2 Left 1036212730 8:6855251-6855273 CCTCACATTGTTCTGGAGGTCAC No data
Right 1036212732 8:6855272-6855294 ACAAGTCTGAAATCTGGTGTTGG No data
1036212730_1036212731 -8 Left 1036212730 8:6855251-6855273 CCTCACATTGTTCTGGAGGTCAC No data
Right 1036212731 8:6855266-6855288 GAGGTCACAAGTCTGAAATCTGG No data
1036212730_1036212734 3 Left 1036212730 8:6855251-6855273 CCTCACATTGTTCTGGAGGTCAC No data
Right 1036212734 8:6855277-6855299 TCTGAAATCTGGTGTTGGCCGGG No data
1036212730_1036212733 2 Left 1036212730 8:6855251-6855273 CCTCACATTGTTCTGGAGGTCAC No data
Right 1036212733 8:6855276-6855298 GTCTGAAATCTGGTGTTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036212730 Original CRISPR GTGACCTCCAGAACAATGTG AGG (reversed) Intergenic
No off target data available for this crispr