ID: 1036212732

View in Genome Browser
Species Human (GRCh38)
Location 8:6855272-6855294
Sequence ACAAGTCTGAAATCTGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036212727_1036212732 14 Left 1036212727 8:6855235-6855257 CCACAAAATTGTACTGCCTCACA No data
Right 1036212732 8:6855272-6855294 ACAAGTCTGAAATCTGGTGTTGG No data
1036212730_1036212732 -2 Left 1036212730 8:6855251-6855273 CCTCACATTGTTCTGGAGGTCAC No data
Right 1036212732 8:6855272-6855294 ACAAGTCTGAAATCTGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036212732 Original CRISPR ACAAGTCTGAAATCTGGTGT TGG Intergenic