ID: 1036212733 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:6855276-6855298 |
Sequence | GTCTGAAATCTGGTGTTGGC CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1036212727_1036212733 | 18 | Left | 1036212727 | 8:6855235-6855257 | CCACAAAATTGTACTGCCTCACA | No data | ||
Right | 1036212733 | 8:6855276-6855298 | GTCTGAAATCTGGTGTTGGCCGG | No data | ||||
1036212730_1036212733 | 2 | Left | 1036212730 | 8:6855251-6855273 | CCTCACATTGTTCTGGAGGTCAC | No data | ||
Right | 1036212733 | 8:6855276-6855298 | GTCTGAAATCTGGTGTTGGCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1036212733 | Original CRISPR | GTCTGAAATCTGGTGTTGGC CGG | Intergenic | ||