ID: 1036212733

View in Genome Browser
Species Human (GRCh38)
Location 8:6855276-6855298
Sequence GTCTGAAATCTGGTGTTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036212727_1036212733 18 Left 1036212727 8:6855235-6855257 CCACAAAATTGTACTGCCTCACA No data
Right 1036212733 8:6855276-6855298 GTCTGAAATCTGGTGTTGGCCGG No data
1036212730_1036212733 2 Left 1036212730 8:6855251-6855273 CCTCACATTGTTCTGGAGGTCAC No data
Right 1036212733 8:6855276-6855298 GTCTGAAATCTGGTGTTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036212733 Original CRISPR GTCTGAAATCTGGTGTTGGC CGG Intergenic
No off target data available for this crispr