ID: 1036212736

View in Genome Browser
Species Human (GRCh38)
Location 8:6855300-6855322
Sequence CAGCATTGTGAGATGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036212736_1036212743 22 Left 1036212736 8:6855300-6855322 CCATGCTCCATCTCACAATGCTG No data
Right 1036212743 8:6855345-6855367 TTCCAGCTTCTGTTAATGGCTGG No data
1036212736_1036212742 18 Left 1036212736 8:6855300-6855322 CCATGCTCCATCTCACAATGCTG No data
Right 1036212742 8:6855341-6855363 CCTCTTCCAGCTTCTGTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036212736 Original CRISPR CAGCATTGTGAGATGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr