ID: 1036212736 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:6855300-6855322 |
| Sequence | CAGCATTGTGAGATGGAGCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1036212736_1036212743 | 22 | Left | 1036212736 | 8:6855300-6855322 | CCATGCTCCATCTCACAATGCTG | No data | ||
| Right | 1036212743 | 8:6855345-6855367 | TTCCAGCTTCTGTTAATGGCTGG | No data | ||||
| 1036212736_1036212742 | 18 | Left | 1036212736 | 8:6855300-6855322 | CCATGCTCCATCTCACAATGCTG | No data | ||
| Right | 1036212742 | 8:6855341-6855363 | CCTCTTCCAGCTTCTGTTAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1036212736 | Original CRISPR | CAGCATTGTGAGATGGAGCA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||